Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T55654 Target Info
Target Name cAMP-dependent chloride channel (CFTR)
Synonyms cAMPdependent chloride channel; Cystic fibrosis transmembrane conductance regulator; Channel conductancecontrolling ATPase; ATPbinding cassette subfamily C member 7; ATP-binding cassette sub-family C member 7; ABCC7
Target Type Successful Target
Gene Name CFTR
Biochemical Class ABC transporter
UniProt ID
P13569
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-145-5p miRNA Info
miRNA Mature AC
MIMAT0000437
Sequence guccaguuuucccaggaaucccu
miRNA Species Homo sapiens
Regulation Mechanism miR-145 directly regulates CFTR expression via inhibition of luciferase expression from a WT-CFTR-3' -UTR reporter. [1]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [1]
2 qPCR [2]
Representative Target(s) Regulated by This miRNA A proliferation-inducing ligand (APRIL) Target Info
TNF13_HUMAN
Alkaline phosphatase (ALPPL2) Target Info
PPBN_HUMAN
miRNA Mature ID hsa-miR-223-3p miRNA Info
miRNA Mature AC
MIMAT0000280
Sequence ugucaguuugucaaauacccca
miRNA Species Homo sapiens
Regulation Mechanism miR-223 directly regulates CFTR expression via inhibition of luciferase expression from a WT-CFTR-3' -UTR reporter,. [1]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [1]
2 Western Blot [3]
Representative Target(s) Regulated by This miRNA ATM serine/threonine kinase (ATM) Target Info
ATM_HUMAN
C-X-C motif chemokine 2 (CXCL2) Target Info
CXCL2_HUMAN
miRNA Mature ID hsa-miR-494-3p miRNA Info
miRNA Mature AC
MIMAT0002816
Sequence ugaaacauacacgggaaaccuc
miRNA Species Homo sapiens
Regulation Mechanism miR-494 directly regulates CFTR expression via inhibition of luciferase expression from a WT-CFTR-3'UTR reporter. [1]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [1]
2 Luciferase Reporter Assay [4]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-144-3p miRNA Info
miRNA Mature AC
MIMAT0000436
Sequence uacaguauagaugauguacu
miRNA Species Homo sapiens
Regulation Mechanism miR-144 were directly targeted the CFTR 3'UTR and suppressed the expression of the CFTR protein. [5]
Evidence Score (E-score) 1 +
1 Immunoblot; Immunohistochemistry; Luciferase Reporter Assay [5]
Representative Target(s) Regulated by This miRNA ADAM metallopeptidase with thrombospondin 1 (ADAMTS1) Target Info
ATS1_HUMAN
Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
miRNA Mature ID hsa-miR-433-3p miRNA Info
miRNA Mature AC
MIMAT0001627
Sequence aucaugaugggcuccucggugu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [6]
Representative Target(s) Regulated by This miRNA cAMP-dependent chloride channel (CFTR) Target Info
CFTR_HUMAN
Cyclic AMP-responsive element-binding protein (CREB1) Target Info
CREB1_HUMAN
References  Top
REF 1 Regulation of cystic fibrosis transmembrane conductance regulator by microRNA-145, -223, and -494 is altered in F508 cystic fibrosis airway epithelium. J Immunol. 2013 Apr 1;190(7):3354-62.
REF 2 MicroRNA-145 Antagonism Reverses TGF- Inhibition of F508del CFTR Correction in Airway Epithelia. Am J Respir Crit Care Med. 2018 Mar 1;197(5):632-643.
REF 3 MicroRNA Expression in Cystic Fibrosis Airway Epithelium. Biomolecules. 2013 Feb 11;3(1):157-67.
REF 4 Synergistic post-transcriptional regulation of the Cystic Fibrosis Transmembrane conductance Regulator (CFTR) by miR-101 and miR-494 specific binding. PLoS One. 2011;6(10):e26601.
REF 5 MiR-101 and miR-144 regulate the expression of the CFTR chloride channel in the lung. PLoS One. 2012;7(11):e50837.
REF 6 Gene mutation in microRNA target sites of CFTR gene: a novel pathogenetic mechanism in cystic fibrosis PLoS One. 2013;8(3):e60448.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.