Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T55465 Target Info
Target Name Neuritin (NRN1)
Synonyms NRN
Target Type Literature-reported Target
Gene Name NRN1
UniProt ID
Q9NPD7
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-182-5p miRNA Info
miRNA Mature AC
MIMAT0000259
Sequence uuuggcaaugguagaacucacacu
miRNA Species Homo sapiens
Regulation Mechanism miR-182 targets NRN1 mRNA by specifically binding to its 3'UTR. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Brain-derived neurotrophic factor (BDNF) Target Info
BDNF_HUMAN
References  Top
REF 1 microRNA-182 inhibits the proliferation and migration of glioma cells through the induction of neuritin expression. Oncol Lett. 2015 Aug;10(2):1197-1203.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.