Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T53890 Target Info
Target Name Gankyrin (PSMD10)
Synonyms p28(GANK); 26S proteasome regulatory subunit p28; 26S proteasome non-ATPase regulatory subunit 10
Target Type Literature-reported Target
Gene Name PSMD10
UniProt ID
O75832
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-214-3p miRNA Info
miRNA Mature AC
MIMAT0000271
Sequence acagcaggcacagacaggcagu
miRNA Species Homo sapiens
Regulation Mechanism miR-214 directly down-regulated the expression of PSMD10. [2]
Evidence Score (E-score) 2 +
1 Dual Luciferase Reporter Assay; Western Blot [1]
2 Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Activating transcription factor 4 (ATF-4) Target Info
ATF4_HUMAN
ADP-ribosylation factor-like protein 2 (ARL2) Target Info
ARL2_HUMAN
miRNA Mature ID hsa-miR-505-3p miRNA Info
miRNA Mature AC
MIMAT0002876
Sequence cgucaacacuugcugguuuccu
miRNA Species Homo sapiens
Regulation Mechanism Co-transfection of the luciferase vector with the PSMD10 3'UTR containing the mutated allele A and hsa-miR-505 into significantly changed the luciferase expression level. [3]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [3]
Representative Target(s) Regulated by This miRNA Gankyrin (PSMD10) Target Info
PSD10_HUMAN
Transforming growth factor alpha (TGFA) Target Info
TGFA_HUMAN
miRNA Mature ID hsa-miR-605-5p miRNA Info
miRNA Mature AC
MIMAT0003273
Sequence uaaaucccauggugccuucuccu
miRNA Species Homo sapiens
Regulation Mechanism miR-605 directly targeted and repressed PSMD10 expression. [4]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [4]
Representative Target(s) Regulated by This miRNA Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
Gankyrin (PSMD10) Target Info
PSD10_HUMAN
References  Top
REF 1 A miR-199a/miR-214 self-regulatory network via PSMD10, TP53 and DNMT1 in testicular germ cell tumor. Sci Rep. 2014 Sep 18;4:6413.
REF 2 Restoration of microRNA-214 expression reduces growth of myeloma cells through positive regulation of P53 and inhibition of DNA replication. Haematologica. 2013 Apr;98(4):640-8.
REF 3 Association between functional PSMD10 Rs111638916 variant regulated by MiR-505 and gastric cancer risk in a Chinese population. Cell Physiol Biochem. 2015;37(3):1010-7.
REF 4 MiR-605 represses PSMD10/Gankyrin and inhibits intrahepatic cholangiocarcinoma cell progression. FEBS Lett. 2014 Sep 17;588(18):3491-500.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.