Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T47623 |
Target Info
|
| Target Name |
Heparanase (HPSE) |
| Synonyms |
Hpa1; Heparanase-1; Heparanase 8 kDa subunit; Heparanase 50 kDa subunit; HSE1; HPSE1; HPR1; HPA; HEP protein; Endo-glucoronidase |
| Target Type |
Successful Target |
| Gene Name |
HPSE |
| Biochemical Class |
Glycosylase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-1258 |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
aguuaggauuaggucguggaa
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
The overexpression of miR-1258 by mature miRNA mimics tranfection resulted in the decreased protein level of target HPSE. |
[1] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Luciferase Reporter Assay; qRT-PCR; Western Blot |
[1] |
| 2 |
qPCR |
[2] |
| Representative Target(s) Regulated by This miRNA |
Heparanase (HPSE)
|
Target Info
|
|
| miRNA Mature ID |
hsa-miR-558 |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
ugagcugcuguaccaaaau
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Luciferase Reporter Assay; Western Blot |
[3] |
| Representative Target(s) Regulated by This miRNA |
Heparanase (HPSE)
|
Target Info
|
|
|
Prostaglandin G/H synthase 2 (COX-2)
|
Target Info
|
|
| References |
Top |
| REF 1 |
MicroRNA-1258 suppresses breast cancer brain metastasis by targeting heparanase. Cancer Res. 2011 Feb 1;71(3):645-54.
|
| REF 2 |
MicroRNA-1258: An invasion and metastasis regulator that targets heparanase in gastric cancer. Oncol Lett. 2017 May;13(5):3739-3745.
|
| REF 3 |
miRNA-558 promotes gastric cancer progression through attenuating Smad4-mediated repression of heparanase expression. Cell Death Dis. 2016 Sep 29;7(9):e2382.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
