miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-1258 | ||||
| miRNA Stemloop AC | MI0006392 | ||||
| miRNA Stemloop ID | hsa-mir-1258 | ||||
| Sequence | aguuaggauuaggucguggaa | ||||
| TTD Target(s) Regulated by This miRNA | Heparanase (HPSE) | Successful Target | Target Info | [1] | |
| Protein(s) Regulated by This miRNA | Mas-related G-protein coupled receptor member F | Regulated Protein | [2] | ||
| References | |||||
| REF 1 | MicroRNA-1258 suppresses breast cancer brain metastasis by targeting heparanase. Cancer Res. 2011 Feb 1;71(3):645-54. | ||||
| REF 2 | Inhibition of Kaposi's sarcoma-associated herpesvirus lytic replication by HIV-1 Nef and cellular microRNA hsa-miR-1258.J Virol. 2014 May;88(9):4987-5000. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.