Target Regulator(s) Information (MicroRNA)
Target General Information | Top | ||||
---|---|---|---|---|---|
Target ID | T44861 | Target Info | |||
Target Name | Protein kinase C delta (PRKCD) | ||||
Synonyms | nPKC-delta; Tyrosine-protein kinase PRKCD; SDK1; Protein kinase C delta type catalytic subunit; Protein kinase C delta type; PKC-delta | ||||
Target Type | Clinical trial Target | ||||
Gene Name | PRKCD | ||||
Biochemical Class | Kinase | ||||
UniProt ID |
The microRNAs (miRNAs) Regulating This Target | Top | ||||
---|---|---|---|---|---|
miRNA Mature ID | hsa-miR-181c-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | aacauucaaccugucggugagu | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | miR-181c regulated the expression of PRKCD by combining with its 3' UTR. | [2] | |||
Evidence Score (E-score) | 2 | + | |||
1 | Dual Luciferase Reporter Assay | [1] | |||
2 | Luciferase Reporter Assay | [2] | |||
Representative Target(s) Regulated by This miRNA | Apoptosis regulator Bcl-2 (BCL-2) | Target Info | |||
Bone morphogenetic protein receptor (BMPR2) | Target Info | ||||
miRNA Mature ID | hsa-miR-26a-1-3p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | ccuauucuugguuacuugcacg | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | miR-26a directly targets PRKCD crucial for insulin signaling and metabolism of lipid and glucose. | [3] | |||
Evidence Score (E-score) | 1 | + | |||
1 | Luciferase Reporter Assay; Western Blot | [3] | |||
Representative Target(s) Regulated by This miRNA | Apoptosis regulator Bcl-2 (BCL-2) | Target Info | |||
Caspase-3 (CASP3) | Target Info |
References | Top | ||||
---|---|---|---|---|---|
REF 1 | MiR-181 family: regulators of myeloid differentiation and acute myeloid leukemia as well as potential therapeutic targets.Oncogene. 2015 Jun;34(25):3226-39. | ||||
REF 2 | MiR181c inhibits ovarian cancer metastasis and progression by targeting PRKCD expression. Int J Clin Exp Med. 2015 Sep 15;8(9):15198-205. | ||||
REF 3 | MicroRNA-26a regulates insulin sensitivity and metabolism of glucose and lipids. J Clin Invest. 2015 Jun;125(6):2497-509. |
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.