Target Regulator(s) Information (MicroRNA)
| Target General Information | Top | ||||
|---|---|---|---|---|---|
| Target ID | T42890 | Target Info | |||
| Target Name | Enhancer of filamentation 1 (NEDD9) | ||||
| Synonyms | p105; hEF1; Renal carcinoma antigen NY-REN-12; Neural precursor cell expressed developmentally down-regulated protein 9; NEDD-9; CasL; Cas scaffolding protein family member 2; CRK-associated substrate-related protein; CASS2; CAS-L | ||||
| Target Type | Literature-reported Target | ||||
| Gene Name | NEDD9 | ||||
| UniProt ID | |||||
| The microRNAs (miRNAs) Regulating This Target | Top | ||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-145-5p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | guccaguuuucccaggaaucccu | ||||
| miRNA Species | Homo sapiens | ||||
| Regulation Mechanism | NEDD9 3'UTR is a target of miR-145. | [3] | |||
| Evidence Score (E-score) | 3 | + | |||
| 1 | Luciferase Reporter Assay | [1] | |||
| 2 | Luciferase Reporter Assay; qRT-PCR | [2] | |||
| 3 | Western Blot | [3] | |||
| Representative Target(s) Regulated by This miRNA | A proliferation-inducing ligand (APRIL) | Target Info | |||
| Alkaline phosphatase (ALPPL2) | Target Info | ||||
| miRNA Mature ID | hsa-miR-18a-5p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | uaaggugcaucuagugcagauag | ||||
| miRNA Species | Homo sapiens | ||||
| Regulation Mechanism | NEDD9 was as novel miR-18a target and was shown to be pro-proliferative genes, with RNA interference of their transcripts decreasing proliferation in CRC cells. | [4] | |||
| Evidence Score (E-score) | 1 | + | |||
| 1 | qRT-PCR; Western Blot | [4] | |||
| Representative Target(s) Regulated by This miRNA | Apoptosis mediating surface antigen FAS (FAS) | Target Info | |||
| Apoptosis regulator Bcl-2 (BCL-2) | Target Info | ||||
| References | Top | ||||
|---|---|---|---|---|---|
| REF 1 | HEF1 promotes epithelial mesenchymal transition and bone invasion in prostate cancer under the regulation of microRNA-145. J Cell Biochem. 2013 Jul;114(7):1606-15. | ||||
| REF 2 | miR-145 functions as tumor suppressor and targets two oncogenes, ANGPT2 and NEDD9, in renal cell carcinoma. J Cancer Res Clin Oncol. 2014 Mar;140(3):387-97. | ||||
| REF 3 | NEDD9, a novel target of miR-145, increases the invasiveness of glioblastoma. Oncotarget. 2012 Jul;3(7):723-34. | ||||
| REF 4 | Histone deacetylase inhibition in colorectal cancer cells reveals competing roles for members of the oncogenic miR-17-92 cluster. Mol Carcinog. 2013 Jun;52(6):459-74. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.