Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T40276 Target Info
Target Name Protein kinase C beta (PRKCB)
Synonyms Protein kinase C beta type; PRKCB1; PKCB; PKC-beta; PKC-B
Target Type Clinical trial Target
Gene Name PRKCB
Biochemical Class Kinase
UniProt ID
P05771
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-184 miRNA Info
miRNA Mature AC
MIMAT0000454
Sequence uggacggagaacugauaagggu
miRNA Species Homo sapiens
Regulation Mechanism PRKCB showed reduced luciferase expression upon co-transfection with miR-184. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Platelet-derived growth factor B (PDGFB) Target Info
PDGFB_HUMAN
miRNA Mature ID hsa-miR-33a-5p miRNA Info
miRNA Mature AC
MIMAT0000091
Sequence gugcauuguaguugcauugca
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [2]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
ATP-binding cassette transporter B11 (ABCB11) Target Info
ABCBB_HUMAN
References  Top
REF 1 Differential expression of miR-184 in temporal lobe epilepsy patients with and without hippocampal sclerosis - Influence on microglial function. Sci Rep. 2016 Sep 26;6:33943.
REF 2 GABAergic mechanisms regulated by miR-33 encode state-dependent fear. Nat Neurosci. 2015 Sep;18(9):1265-71.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.