Content Navigation
( All
None )
Target General Information |
Top |
Target ID |
T33976 |
Target Info
|
Target Name |
Transferrin receptor protein 1 (TFRC) |
Synonyms |
Trfr; TfR1; TfR; TR protein; T9; P90; CD71 antigen; CD71 |
Target Type |
Clinical trial Target |
Gene Name |
TFRC |
Biochemical Class |
Peptidase |
UniProt ID |
|
The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-210-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
cugugcgugugacagcggcuga
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
2 |
+ |
1 |
HITS-CLIP |
[1] |
2 |
Immunoblot; Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR |
[2] |
Representative Target(s) Regulated by This miRNA |
Activin receptor type IB (ACVR1B)
|
Target Info
|
|
Autophagy-related protein 7 (ATG7)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-200a-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uaacacugucugguaacgaugu
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Northern Blot |
[3] |
Representative Target(s) Regulated by This miRNA |
Amphiregulin (AREG)
|
Target Info
|
|
Beta-catenin (CTNNB1)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-22-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
aagcugccaguugaagaacugu
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Northern Blot |
[3] |
Representative Target(s) Regulated by This miRNA |
5-HT 2C receptor (HTR2C)
|
Target Info
|
|
ATP-citrate synthase (ACLY)
|
Target Info
|
|
References |
Top |
REF 1 |
EBV and human microRNAs co-target oncogenic and apoptotic viral and human genes during latency. EMBO J. 2012 May 2;31(9):2207-21.
|
REF 2 |
Micromanaging Iron Homeostasis: hypoxia-inducible micro-RNA-210 suppresses iron homeostasis-related proteins. J Biol Chem. 2012 Oct 5;287(41):34110-9.
|
REF 3 |
miR-320 targets transferrin receptor 1 (CD71) and inhibits cell proliferation. Exp Hematol. 2009 Feb;37(2):245-55.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.