Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T28758 |
Target Info
|
| Target Name |
DEK protein (DEK) |
| Synonyms |
Protein DEK |
| Target Type |
Literature-reported Target |
| Gene Name |
DEK |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-200a-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uaacacugucugguaacgaugu
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR-200a suppresses the metastasis in pancreatic PDAC through downregulation of DEK. |
[1] |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Immunohistochemistry; Luciferase Reporter Assay; Western Blot |
[1] |
| Representative Target(s) Regulated by This miRNA |
Amphiregulin (AREG)
|
Target Info
|
|
|
Beta-catenin (CTNNB1)
|
Target Info
|
|
| miRNA Mature ID |
hsa-miR-592 |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uugugucaauaugcgaugaugu
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR-592 binds directly to the 3'UTR of DEK, thereby repressing gene expression. Overexpression of miR-592 reduced DEK protein expression and blockage of miR-592 enhanced DEK protein expression. |
[2] |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Luciferase Reporter Assay; Western Blot |
[2] |
| Representative Target(s) Regulated by This miRNA |
DEK protein (DEK)
|
Target Info
|
|
| References |
Top |
| REF 1 |
MiR-200a Suppresses the Proliferation and Metastasis in Pancreatic Ductal Adenocarcinoma through Downregulation of DEK Gene. Transl Oncol. 2016 Feb;9(1):25-31.
|
| REF 2 |
MicroRNA-592 targets DEK oncogene and suppresses cell growth in the hepatocellular carcinoma cell line HepG2. Int J Clin Exp Pathol. 2015 Oct 1;8(10):12455-63.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
