miRNA General Information
miRNA Mature ID hsa-miR-592
miRNA Stemloop AC MI0003604
miRNA Stemloop ID hsa-mir-592
Sequence uugugucaauaugcgaugaugu
TTD Target(s) Regulated by This miRNA DEK protein (DEK) Literature-reported Target Target Info [1]
Protein(s) Regulated by This miRNA Forkhead box protein O3 Regulated Protein [2]
Transcription factor SOX-9 Regulated Protein [3]
References
REF 1 MicroRNA-592 targets DEK oncogene and suppresses cell growth in the hepatocellular carcinoma cell line HepG2. Int J Clin Exp Pathol. 2015 Oct 1;8(10):12455-63.
REF 2 MiR-592 represses FOXO3 expression and promotes the proliferation of prostate cancer cells. Int J Clin Exp Med. 2015 Sep 15;8(9):15246-53.
REF 3 miR-592 functions as a tumor suppressor in human non-small cell lung cancer by targeting SOX9.Oncol Rep. 2017 Jan;37(1):297-304.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.