miRNA Details
miRNA General Information | |||||
---|---|---|---|---|---|
miRNA Mature ID | hsa-miR-592 | ||||
miRNA Stemloop AC | MI0003604 | ||||
miRNA Stemloop ID | hsa-mir-592 | ||||
Sequence | uugugucaauaugcgaugaugu | ||||
TTD Target(s) Regulated by This miRNA | DEK protein (DEK) | Literature-reported Target | Target Info | [1] | |
Protein(s) Regulated by This miRNA | Forkhead box protein O3 | Regulated Protein | [2] | ||
Transcription factor SOX-9 | Regulated Protein | [3] | |||
References | |||||
REF 1 | MicroRNA-592 targets DEK oncogene and suppresses cell growth in the hepatocellular carcinoma cell line HepG2. Int J Clin Exp Pathol. 2015 Oct 1;8(10):12455-63. | ||||
REF 2 | MiR-592 represses FOXO3 expression and promotes the proliferation of prostate cancer cells. Int J Clin Exp Med. 2015 Sep 15;8(9):15246-53. | ||||
REF 3 | miR-592 functions as a tumor suppressor in human non-small cell lung cancer by targeting SOX9.Oncol Rep. 2017 Jan;37(1):297-304. |
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.