Content Navigation
( All
None )
Target General Information |
Top |
Target ID |
T28713 |
Target Info
|
Target Name |
Serine/threonine-protein kinase Chk2 (RAD53) |
Synonyms |
hCds1; Hucds1; Checkpoint kinase 2; Cds1 homolog; Cds1; CHK2 checkpoint homolog; CHK2 |
Target Type |
Clinical trial Target |
Gene Name |
CHEK2 |
Biochemical Class |
Kinase |
UniProt ID |
|
The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-182-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uuuggcaaugguagaacucacacu
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[1] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
Brain-derived neurotrophic factor (BDNF)
|
Target Info
|
|
References |
Top |
REF 1 |
MicroRNA-182-5p targets a network of genes involved in DNA repair. RNA. 2013 Feb;19(2):230-42.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.