Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T26983 Target Info
Target Name Tumor suppressor p53-binding protein 1 (TP53BP1)
Synonyms p53BP1; p53-binding protein 1; TP53-binding protein 1; 53BP1
Target Type Literature-reported Target
Gene Name TP53BP1
UniProt ID
Q12888
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-182-5p miRNA Info
miRNA Mature AC
MIMAT0000259
Sequence uuuggcaaugguagaacucacacu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Brain-derived neurotrophic factor (BDNF) Target Info
BDNF_HUMAN
References  Top
REF 1 MicroRNA-182-5p targets a network of genes involved in DNA repair. RNA. 2013 Feb;19(2):230-42.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.