| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-144-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uacaguauagaugauguacu
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
ELISA; Luciferase Reporter Assay |
[1] |
| Representative Target(s) Regulated by This miRNA |
ADAM metallopeptidase with thrombospondin 1 (ADAMTS1)
|
Target Info
|
|
|
Amyloid beta A4 protein (APP)
|
Target Info
|
|
| miRNA Mature ID |
hsa-miR-29a-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uagcaccaucugaaaucgguua
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
The FGG mRNA level is reduced when HuH7 cells were transfected with hsa-miR-29a. |
[1] |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
ELISA; Luciferase Reporter Assay |
[1] |
| Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
|
Aryl hydrocarbon receptor (AHR)
|
Target Info
|
|
| miRNA Mature ID |
hsa-miR-29c-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uagcaccauuugaaaucgguua
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
A direct effect of hsa-miR-29c on luciferase activity from the reporter plasmid shows the FGG 3'UTR but not for the reporter plasmids carrying the other fibrinogen mRNA 3'UTR. |
[1] |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Luciferase Reporter Assay |
[1] |
| Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
|
B7 homolog 3 (CD276)
|
Target Info
|
|
| miRNA Mature ID |
hsa-miR-409-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
gaauguugcucggugaaccccu
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
ELISA; Luciferase Reporter Assay |
[1] |
| Representative Target(s) Regulated by This miRNA |
Angiogenin (ANG)
|
Target Info
|
|
|
Fibrinogen (FGG)
|
Target Info
|
|
