Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T25362 Target Info
Target Name Lysine-specific demethylase 3A (KDM3A)
Synonyms TSGA; KIAA0742; Jumonji domain-containing protein 1A; JmjC domain-containing histone demethylation protein 2A; JMJD1A; JMJD1; JHDM2A
Target Type Literature-reported Target
Gene Name KDM3A
Biochemical Class Paired donor oxygen oxidoreductase
UniProt ID
Q9Y4C1
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-155-5p miRNA Info
miRNA Mature AC
MIMAT0000646
Sequence uuaaugcuaaucgugauagggguu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 In Situ Hybridization; Luciferase Reporter Assay; Western Blot; Immunohistochemistry; Microarray [1]
Representative Target(s) Regulated by This miRNA Acetyl-CoA transporter (SLC33A1) Target Info
ACATN_HUMAN
Angiotensin II receptor type-1 (AGTR1) Target Info
AGTR1_HUMAN
miRNA Mature ID hsa-miR-627-5p miRNA Info
miRNA Mature AC
MIMAT0003296
Sequence gugagucucuaagaaaagagga
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 GFP Reporter Assay; Western Blot [2]
Representative Target(s) Regulated by This miRNA Lysine-specific demethylase 3A (KDM3A) Target Info
KDM3A_HUMAN
References  Top
REF 1 Upregulation of MiR-155 in nasopharyngeal carcinoma is partly driven by LMP1 and LMP2A and downregulates a negative prognostic marker JMJD1A. PLoS One. 2011 Apr 26;6(4):e19137.
REF 2 MicroRNA-627 mediates the epigenetic mechanisms of vitamin D to suppress proliferation of human colorectal cancer cells and growth of xenograft tumors in mice. Gastroenterology. 2013 Aug;145(2):437-46.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.