Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T25258 Target Info
Target Name Multidrug resistance protein 1 (ABCB1)
Synonyms PGY1; P-glycoprotein 1; P-gp; Pgp; MDR1; CD243 antigen; CD243; ATP-binding cassette sub-family B member 1
Target Type Clinical trial Target
Gene Name ABCB1
Biochemical Class ABC transporter
UniProt ID
P08183
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-223-3p miRNA Info
miRNA Mature AC
MIMAT0000280
Sequence ugucaguuugucaaauacccca
miRNA Species Homo sapiens
Regulation Mechanism EGFP reporter assay, real-time PCR and Western blot were performed to verify that miR-223 targeted ABCB1 3'UTR directly. [1]
Evidence Score (E-score) 2 +
1 GFP Reporter Assay; Western Blot [1]
2 qPCR [2]
Representative Target(s) Regulated by This miRNA ATM serine/threonine kinase (ATM) Target Info
ATM_HUMAN
C-X-C motif chemokine 2 (CXCL2) Target Info
CXCL2_HUMAN
miRNA Mature ID hsa-miR-186-5p miRNA Info
miRNA Mature AC
MIMAT0000456
Sequence caaagaauucuccuuuugggcu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [3]
Representative Target(s) Regulated by This miRNA Casein kinase II alpha (CSNK2A1) Target Info
CSK21_HUMAN
Fibroblast growth factor-2 (FGF2) Target Info
FGF2_HUMAN
miRNA Mature ID hsa-miR-21-5p miRNA Info
miRNA Mature AC
MIMAT0000076
Sequence uagcuuaucagacugauguuga
miRNA Species Homo sapiens
Regulation Mechanism miR-21 may modulate the sensitivity to PTX, at least in part, by regulating the expression of P-glycoprotein. [4]
Evidence Score (E-score) 1 +
1 Western Blot [4]
Representative Target(s) Regulated by This miRNA Apoptosis antigen ligand (CD178) Target Info
TNFL6_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-296-5p miRNA Info
miRNA Mature AC
MIMAT0000690
Sequence agggcccccccucaauccugu
miRNA Species Homo sapiens
Regulation Mechanism The downregulation of miR-296-5p resulted in the changed protein level of target ABCB1. [5]
Evidence Score (E-score) 1 +
1 Western Blot; qRT-PCR [5]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Bcl-2-binding component 3 (BBC3) Target Info
BBC3_HUMAN
miRNA Mature ID hsa-miR-34b-3p miRNA Info
miRNA Mature AC
MIMAT0004676
Sequence caaucacuaacuccacugccau
miRNA Species Homo sapiens
Regulation Mechanism ABCB1 is a direct target of miR-34b. [6]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [6]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Cyclic AMP-responsive element-binding protein (CREB1) Target Info
CREB1_HUMAN
miRNA Mature ID hsa-miR-451a miRNA Info
miRNA Mature AC
MIMAT0001631
Sequence aaaccguuaccauuacugaguu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-451a by mature miRNA precursor transfection resulted in the changed mRNA level of target ABCB1. [5]
Evidence Score (E-score) 1 +
1 qRT-PCR; Luciferase Reporter Assay; Western Blot [5]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Extracellular signal-regulated kinase 2 (ERK2) Target Info
MK01_HUMAN
miRNA Mature ID hsa-miR-495-3p miRNA Info
miRNA Mature AC
MIMAT0002817
Sequence aaacaaacauggugcacuucuu
miRNA Species Homo sapiens
Regulation Mechanism miR-495 can target ABCB1, which encodes protein MDR1. [7]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [7]
Representative Target(s) Regulated by This miRNA Endoplasmic reticulum chaperone BiP (HSPA5) Target Info
BIP_HUMAN
Forkhead box protein C1 (FOXC1) Target Info
FOXC1_HUMAN
miRNA Mature ID hsa-miR-491-3p miRNA Info
miRNA Mature AC
MIMAT0004765
Sequence cuuaugcaagauucccuucuac
miRNA Species Homo sapiens
Regulation Mechanism miR-491-3P inhibition can decrease ABCB1 by targeting 3'UTR of ABCB1. [8]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [8]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
Insulin-like growth factor-binding protein 2 (IGFBP2) Target Info
IBP2_HUMAN
miRNA Mature ID hsa-miR-873-5p miRNA Info
miRNA Mature AC
MIMAT0004953
Sequence gcaggaacuugugagucuccu
miRNA Species Homo sapiens
Regulation Mechanism miR-873 can bind region in the 3'untranslated region of ABCB1 by dual-luciferase reporter assay confirmed this prediction. [9]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [9]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 3 (CDK3) Target Info
CDK3_HUMAN
Multidrug resistance protein 1 (ABCB1) Target Info
MDR1_HUMAN
miRNA Mature ID hsa-miR-508-5p miRNA Info
miRNA Mature AC
MIMAT0004778
Sequence uacuccagagggcgucacucaug
miRNA Species Homo sapiens
Regulation Mechanism miR-508-5p could directly target the 3'-untranslated regions of ABCB1 and Zinc ribbon domain-containing 1 (ZNRD1), and suppress their expression at mRNA and protein levels. [10]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [10]
Representative Target(s) Regulated by This miRNA Multidrug resistance protein 1 (ABCB1) Target Info
MDR1_HUMAN
References  Top
REF 1 MiR-223 modulates multidrug resistance via downregulation of ABCB1 in hepatocellular carcinoma cells. Exp Biol Med (Maywood). 2013 Sep;238(9):1024-32.
REF 2 A single miRNA and miRNA sponge expression system for efficient modulation of miR-223 availability in mammalian cells. J Gene Med. 2019 Aug;21(8):e3100.
REF 3 MicroRNA-186 induces sensitivity of ovarian cancer cells to paclitaxel and cisplatin by targeting ABCB1. J Ovarian Res. 2015 Dec 2;8:80.
REF 4 Antagonism of miRNA-21 Sensitizes Human Gastric Cancer Cells to Paclitaxel. Cell Biochem Biophys. 2015 May;72(1):275-82.
REF 5 Involvement of microRNA-451 in resistance of the MCF-7 breast cancer cells to chemotherapeutic drug doxorubicin. Mol Cancer Ther. 2008 Jul;7(7):2152-9.
REF 6 Sirolimus induces apoptosis and reverses multidrug resistance in human osteosarcoma cells in vitro via increasing microRNA-34b expression. Acta Pharmacol Sin. 2016 Apr;37(4):519-29.
REF 7 miR-495 sensitizes MDR cancer cells to the combination of doxorubicin and taxol by inhibiting MDR1 expression. J Cell Mol Med. 2017 Sep;21(9):1929-1943.
REF 8 Atorvastatin attenuation of ABCB1 expression is mediated by microRNA miR-491-3p in Caco-2 cells. Eur J Pharm Sci. 2016 Oct 10;93:431-6.
REF 9 MicroRNA-873 mediates multidrug resistance in ovarian cancer cells by targeting ABCB1. Tumour Biol. 2016 Aug;37(8):10499-506.
REF 10 miR-508-5p regulates multidrug resistance of gastric cancer by targeting ABCB1 and ZNRD1. Oncogene. 2014 Jun 19;33(25):3267-76.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.