Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T25076 Target Info
Target Name Endothelin-1 (EDN1)
Synonyms Preproendothelin-1; PPET1
Target Type Literature-reported Target
Gene Name EDN1
Biochemical Class Endothelin/sarafotoxin
UniProt ID
P05305
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-125a-5p miRNA Info
miRNA Mature AC
MIMAT0000443
Sequence ucccugagacccuuuaaccuguga
miRNA Species Homo sapiens
Regulation Mechanism EDN1 is a target of miR-125a. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Apoptosis regulator BAK (BAK) Target Info
BAK_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-155-5p miRNA Info
miRNA Mature AC
MIMAT0000646
Sequence uuaaugcuaaucgugauagggguu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Acetyl-CoA transporter (SLC33A1) Target Info
ACATN_HUMAN
Angiotensin II receptor type-1 (AGTR1) Target Info
AGTR1_HUMAN
miRNA Mature ID hsa-miR-98-5p miRNA Info
miRNA Mature AC
MIMAT0000096
Sequence ugagguaguaaguuguauuguu
miRNA Species Homo sapiens
Regulation Mechanism EDN1 is a target of miR-98 and miR-98 binds to the EDN1 3'UTR. [3]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [3]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Aromatase (CYP19A1) Target Info
CP19A_HUMAN
miRNA Mature ID hsa-miR-648 miRNA Info
miRNA Mature AC
MIMAT0003318
Sequence aagugugcagggcacuggu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Northern Blot; Western Blot [4]
Representative Target(s) Regulated by This miRNA Endothelin-1 (EDN1) Target Info
EDN1_HUMAN
O-6-methylguanine-DNA-alkyltransferase (MGMT) Target Info
MGMT_HUMAN
References  Top
REF 1 A Single-Nucleotide Polymorphism in 3'-Untranslated Region of Endothelin-1 Reduces Risk of Dementia After Ischemic Stroke. Med Sci Monit. 2016 Apr 23;22:1368-74.
REF 2 Ethanol-induced expression of ET-1 and ET-BR in liver sinusoidal endothelial cells and human endothelial cells involves hypoxia-inducible factor-1alpha and microrNA-199. J Immunol. 2009 Oct 15;183(8):5232-43.
REF 3 Peroxisome Proliferator-Activated Receptor and microRNA 98 in Hypoxia-Induced Endothelin-1 Signaling. Am J Respir Cell Mol Biol. 2016 Jan;54(1):136-46.
REF 4 MicroRNA 648 Targets ET-1 mRNA and is cotranscriptionally regulated with MICAL3 by PAX5. Mol Cell Biol. 2015 Feb;35(3):514-28.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.