The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-145-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
guccaguuuucccaggaaucccu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-145 overexpression resulted in decreased protein and transcriptional levels of HIF-2a in NB cells,. |
[1] |
Evidence Score (E-score) |
2 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[1] |
2 |
qRT-PCR |
[2] |
Representative Target(s) Regulated by This miRNA |
A proliferation-inducing ligand (APRIL)
|
Target Info
|
|
Alkaline phosphatase (ALPPL2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-17-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
caaagugcuuacagugcagguag
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-17 mediates post-transcriptional suppression of HIF2A expression. |
[3] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[3] |
Representative Target(s) Regulated by This miRNA |
Amyloid beta A4 protein (APP)
|
Target Info
|
|
Apoptosis mediating surface antigen FAS (FAS)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-185-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uggagagaaaggcaguuccuga
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-185 is a highly conserved miR-200c that is predicted to have two target binding sites in the human HIF-2A 3'UTR. |
[4] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[4] |
Representative Target(s) Regulated by This miRNA |
Androgen receptor (AR)
|
Target Info
|
|
Arachidonate 12-lipoxygenase (12-LOX)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-20a-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uaaagugcuuauagugcagguag
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-20 mediates post-transcriptional suppression of HIF2A expression. |
[3] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[3] |
Representative Target(s) Regulated by This miRNA |
Amyloid beta A4 protein (APP)
|
Target Info
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|