Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T16459 Target Info
Target Name CDK inhibitor 1C p57Kip2 (CDKN1C)
Synonyms P57KIP2; P57(KIP2); KIP2; Cyclin-dependent kinase inhibitor p57; Cyclin-dependent kinase inhibitor 1C
Target Type Literature-reported Target
Gene Name CDKN1C
UniProt ID
P49918
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-221-3p miRNA Info
miRNA Mature AC
MIMAT0000278
Sequence agcuacauugucugcuggguuuc
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-221-3p by mature miRNA precursor transfection resulted in the decreased protein level of target CDKN1C. [2]
Evidence Score (E-score) 5 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [1]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot; Northern Blot [2]
3 qRT-PCR; Luciferase Reporter Assay; Western Blot [3]
4 Reporter Assay; Luciferase Reporter Assay; qRT-PCR; Western Blot; Northern Blot [4]
5 Reporter Assay; Microarray [5]
Representative Target(s) Regulated by This miRNA Bcl-2-binding component 3 (BBC3) Target Info
BBC3_HUMAN
Beclin-1 (BECN1) Target Info
BECN1_HUMAN
miRNA Mature ID hsa-miR-222-3p miRNA Info
miRNA Mature AC
MIMAT0000279
Sequence agcuacaucuggcuacugggu
miRNA Species Homo sapiens
Regulation Mechanism The downregulation of miR-222-3p by Anti-miRNA Oligonucleotide resulted in the changed protein level of target CDKN1C. [2]
Evidence Score (E-score) 3 +
1 Luciferase Reporter Assay; Western Blot [6]
2 Luciferase Reporter Assay; Western Blot; Luciferase Immunocytochemistry [2]
3 qRT-PCR; Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA AN1-type zinc finger protein 5 (ZFAND5) Target Info
ZFAN5_HUMAN
ATP-binding cassette transporter G2 (ABCG2) Target Info
ABCG2_HUMAN
miRNA Mature ID hsa-miR-92b-3p miRNA Info
miRNA Mature AC
MIMAT0003218
Sequence uauugcacucgucccggccucc
miRNA Species Homo sapiens
Regulation Mechanism The downregulation of miR-92b-3p by Anti-miRNA Oligonucleotide resulted in the changed protein level of target CDKN1C. [2]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [7]
2 Luciferase Reporter Assay; Western Blot [2]
Representative Target(s) Regulated by This miRNA CDK inhibitor 1C p57Kip2 (CDKN1C) Target Info
CDN1C_HUMAN
Dickkopf-related protein 3 (DKK3) Target Info
DKK3_HUMAN
miRNA Mature ID hsa-miR-25-3p miRNA Info
miRNA Mature AC
MIMAT0000081
Sequence cauugcacuugucucggucuga
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA CDK inhibitor 1C p57Kip2 (CDKN1C) Target Info
CDN1C_HUMAN
Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
miRNA Mature ID hsa-miR-221-5p miRNA Info
miRNA Mature AC
MIMAT0004568
Sequence accuggcauacaauguagauuu
miRNA Species Homo sapiens
Regulation Mechanism miR blocking experiments confirmed that miR-221 target p57KIP2 expression in LCLs. [8]
Evidence Score (E-score) 1 +
1 Co-Immunoprecipitation; Chromatin Immunoprecipitation; Western Blot [8]
Representative Target(s) Regulated by This miRNA CDK inhibitor 1B p27Kip1 (CDKN1B) Target Info
CDN1B_HUMAN
CDK inhibitor 1C p57Kip2 (CDKN1C) Target Info
CDN1C_HUMAN
miRNA Mature ID hsa-miR-222-5p miRNA Info
miRNA Mature AC
MIMAT0004569
Sequence cucaguagccaguguagauccu
miRNA Species Homo sapiens
Regulation Mechanism miR blocking experiments confirmed that miR-222 target p57KIP2 expression in LCLs. [8]
Evidence Score (E-score) 1 +
1 Co-Immunoprecipitation; Chromatin Immunoprecipitation; Western Blot [8]
Representative Target(s) Regulated by This miRNA CDK inhibitor 1C p57Kip2 (CDKN1C) Target Info
CDN1C_HUMAN
References  Top
REF 1 MicroRNA-221 inhibits CDKN1C/p57 expression in human colorectal carcinoma. Acta Pharmacol Sin. 2011 Mar;32(3):375-84.
REF 2 MicroRNAs 221 and 222 bypass quiescence and compromise cell survival. Cancer Res. 2008 Apr 15;68(8):2773-80.
REF 3 Functional links between clustered microRNAs: suppression of cell-cycle inhibitors by microRNA clusters in gastric cancer. Nucleic Acids Res. 2009 Apr;37(5):1672-81.
REF 4 MiR-221 controls CDKN1C/p57 and CDKN1B/p27 expression in human hepatocellular carcinoma. Oncogene. 2008 Sep 25;27(43):5651-61.
REF 5 miR-221 overexpression contributes to liver tumorigenesis. Proc Natl Acad Sci U S A. 2010 Jan 5;107(1):264-9.
REF 6 Hsa-miR-222 is involved in differentiation of endometrial stromal cells in vitro. Endocrinology. 2009 Oct;150(10):4734-43.
REF 7 MicroRNA 92b controls the G1/S checkpoint gene p57 in human embryonic stem cells. Stem Cells. 2009 Jul;27(7):1524-8.
REF 8 Epstein-Barr Virus Proteins EBNA3A and EBNA3C Together Induce Expression of the Oncogenic MicroRNA Cluster miR-221/miR-222 and Ablate Expression of Its Target p57KIP2. PLoS Pathog. 2015 Jul 8;11(7):e1005031.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.