Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T16452 Target Info
Target Name Multiple tumor suppressor 1 (CDKN2A)
Synonyms p16INK4A; Tumour suppressor gene p16; P16-INK4a; P16-INK4; P16 gene; MTS-1; Cyclin-dependent kinase inhibitor 2A; Cyclin-dependent kinase 4 inhibitor A; CDK4I
Target Type Literature-reported Target
Gene Name CDKN2A
UniProt ID
P42771
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-let-7g-5p miRNA Info
miRNA Mature AC
MIMAT0000414
Sequence ugagguaguaguuuguacaguu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-xL (BCL-xL) Target Info
B2CL1_HUMAN
Caspase-3 (CASP3) Target Info
CASP3_HUMAN
miRNA Mature ID hsa-miR-10b-5p miRNA Info
miRNA Mature AC
MIMAT0000254
Sequence uacccuguagaaccgaauuugug
miRNA Species Homo sapiens
Regulation Mechanism miR-10b directly regulates CDKN2A. [2]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [2]
Representative Target(s) Regulated by This miRNA Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
Cyclic AMP-responsive element-binding protein (CREB1) Target Info
CREB1_HUMAN
miRNA Mature ID hsa-miR-125b-5p miRNA Info
miRNA Mature AC
MIMAT0000423
Sequence ucccugagacccuaacuuguga
miRNA Species Homo sapiens
Regulation Mechanism The downregulation of miR-125b-5p by Anti-miRNA Oligonucleotide resulted in the changed protein level of target CDKN2A. [3]
Evidence Score (E-score) 1 +
1 Western Blot [3]
Representative Target(s) Regulated by This miRNA Apoptosis regulator BAK (BAK) Target Info
BAK_HUMAN
Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
miRNA Mature ID hsa-miR-24-3p miRNA Info
miRNA Mature AC
MIMAT0000080
Sequence uggcucaguucagcaggaacag
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-24-3p by mature miRNA precursor transfection resulted in the decreased protein level of target CDKN2A; The Underexpression by 2'-O-Me Antisense miRNA Oligonucleotides resulted in the increased protein level of target CDKN2A. [3]
Evidence Score (E-score) 1 +
1 Western Blot; qRT-PCR [3]
Representative Target(s) Regulated by This miRNA Activin receptor type IB (ACVR1B) Target Info
ACV1B_HUMAN
Aurora kinase B (AURKB) Target Info
AURKB_HUMAN
miRNA Mature ID hsa-miR-34a-5p miRNA Info
miRNA Mature AC
MIMAT0000255
Sequence uggcagugucuuagcugguugu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Western Blot [4]
Representative Target(s) Regulated by This miRNA Amphiregulin (AREG) Target Info
AREG_HUMAN
Androgen receptor (AR) Target Info
ANDR_HUMAN
miRNA Mature ID hsa-miR-492 miRNA Info
miRNA Mature AC
MIMAT0002812
Sequence aggaccugcgggacaagauucuu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Microarray [5]
Representative Target(s) Regulated by This miRNA Basigin (BSG) Target Info
BASI_HUMAN
Multiple tumor suppressor 1 (CDKN2A) Target Info
CDN2A_HUMAN
References  Top
REF 1 Hsa-let-7g inhibits proliferation of hepatocellular carcinoma cells by downregulation of c-Myc and upregulation of p16(INK4A). Int J Cancer. 2011 Jan 15;128(2):319-31.
REF 2 Human glioma growth is controlled by microRNA-10b. Cancer Res. 2011 May 15;71(10):3563-72.
REF 3 p16(INK4a) translation suppressed by miR-24. PLoS One. 2008 Mar 26;3(3):e1864.
REF 4 Upregulation of p18Ink4c expression by oncogenic HPV E6 via p53-miR-34a pathway. Int J Cancer. 2011 Sep 15;129(6):1362-72.
REF 5 MicroRNA-492 is processed from the keratin 19 gene and up-regulated in metastatic hepatoblastoma. Hepatology. 2011 Mar;53(3):833-42.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.