The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-139-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ucuacagugcacgugucuccagu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-139-5p Suppresses NR5A2 Expression by Binding to 3'UTR Sequence. |
[1] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[1] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
C-X-C chemokine receptor type 4 (CXCR4)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-27b-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uucacaguggcuaaguucugc
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-27b-3p directly targeted and inhibited the expression of nuclear receptor subfamily 5 group A member 2 (NR5A2) and therefore augmented tamoxifen-induced cytotoxicity in breast cancer. |
[2] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[2] |
Representative Target(s) Regulated by This miRNA |
Adenosine A2b receptor (ADORA2B)
|
Target Info
|
|
Albendazole monooxygenase (CYP3A4)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-376c-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
aacauagaggaaauuccacgu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-376c directly targeted the 3'untranslated region (UTR) of NR5A2 and negatively regulated NR5A2 expression. |
[3] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[3] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
Insulin-like growth factor I receptor (IGF1R)
|
Target Info
|
|