Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T13251 |
Target Info
|
| Target Name |
Interleukin-12 alpha (IL12A) |
| Synonyms |
NKSF1; NKSF; NK cell stimulatory factor chain 1; NK cell stimulatory factor; Interleukin-12 subunit alpha; IL-12A; IL-12 subunit p35; IL-12; Cytotoxic lymphocyte maturation factor 35 kDa subunit; CLMF p35 |
| Target Type |
Successful Target |
| Gene Name |
IL12A |
| Biochemical Class |
Cytokine: interleukin |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-21-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uagcuuaucagacugauguuga
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
3 |
+ |
| 1 |
Luciferase Reporter Assay; qRT-PCR; Western Blot |
[1] |
| 2 |
Luciferase Reporter Assay; Western Blot |
[2] |
| 3 |
Microarray |
[3] |
| Representative Target(s) Regulated by This miRNA |
Apoptosis antigen ligand (CD178)
|
Target Info
|
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
| miRNA Mature ID |
hsa-miR-10a-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uacccuguagauccgaauuugug
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR-10a targets IL12A and inhibits its expression. |
[4] |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
ELISA |
[4] |
| Representative Target(s) Regulated by This miRNA |
AN1-type zinc finger protein 5 (ZFAND5)
|
Target Info
|
|
|
Brain-derived neurotrophic factor (BDNF)
|
Target Info
|
|
| References |
Top |
| REF 1 |
HBx-induced miR-21 suppresses cell apoptosis in hepatocellular carcinoma by targeting interleukin-12. Oncol Rep. 2016 Oct;36(4):2305-12.
|
| REF 2 |
Regulation of NF-B signaling by oxidized glycerophospholipid and IL-1 induced miRs-21-3p and -27a-5p in human aortic endothelial cells. J Lipid Res. 2015 Jan;56(1):38-50.
|
| REF 3 |
MicroRNA profiling in mucosal biopsies of eosinophilic esophagitis patients pre and post treatment with steroids and relationship with mRNA targets. PLoS One. 2012;7(7):e40676.
|
| REF 4 |
miR-10a inhibits dendritic cell activation and Th1/Th17 cell immune responses in IBD. Gut. 2015 Nov;64(11):1755-64.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
