Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T11966 Target Info
Target Name Cyclic-AMP-dependent transcription factor ATF-3 (ATF3)
Synonyms cAMP-dependent transcription factor ATF-3; Cyclic AMP-dependent transcription factor ATF-3; Activating transcription factor 3
Target Type Literature-reported Target
Gene Name ATF3
Biochemical Class Basic leucine zipper bZIP
UniProt ID
P18847
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-30a-3p miRNA Info
miRNA Mature AC
MIMAT0000088
Sequence cuuucagucggauguuugcagc
miRNA Species Homo sapiens
Regulation Mechanism ATF3 was a potential target of miR-30a-3p. [1]
Evidence Score (E-score) 2 +
1 Immunohistochemistry [1]
2 Western Blot [2]
Representative Target(s) Regulated by This miRNA Beclin-1 (BECN1) Target Info
BECN1_HUMAN
Cyclic-AMP-dependent transcription factor ATF-3 (ATF3) Target Info
ATF3_HUMAN
miRNA Mature ID hsa-miR-590-5p miRNA Info
miRNA Mature AC
MIMAT0003258
Sequence gagcuuauucauaaaagugcag
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 qRT-PCR; Western Blot [3]
2 Western Blot? [4]
Representative Target(s) Regulated by This miRNA Cyclic-AMP-dependent transcription factor ATF-3 (ATF3) Target Info
ATF3_HUMAN
Lectin-like oxidized LDL receptor (OLR1) Target Info
OLR1_HUMAN
miRNA Mature ID hsa-miR-494-3p miRNA Info
miRNA Mature AC
MIMAT0002816
Sequence ugaaacauacacgggaaaccuc
miRNA Species Homo sapiens
Regulation Mechanism miR-494 binds to the 3'UTR of activating transcription factor 3 (ATF3) and decreases its transcription. [5]
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [5]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-30c-2-3p miRNA Info
miRNA Mature AC
MIMAT0004550
Sequence cugggagaaggcuguuuacucu
miRNA Species Homo sapiens
Regulation Mechanism miR-30c-2-3p binds to the 3'UTR of ATF3 and reduces mRNA and protein expression. [6]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [6]
Representative Target(s) Regulated by This miRNA Cyclic-AMP-dependent transcription factor ATF-3 (ATF3) Target Info
ATF3_HUMAN
G1/S-specific cyclin-E1 (CCNE1) Target Info
CCNE1_HUMAN
miRNA Mature ID hsa-miR-30e-3p miRNA Info
miRNA Mature AC
MIMAT0000693
Sequence cuuucagucggauguuuacagc
miRNA Species Homo sapiens
Regulation Mechanism ATF3 was a potential target of miR-30e. [1]
Evidence Score (E-score) 1 +
1 Immunohistochemistry [1]
Representative Target(s) Regulated by This miRNA Cyclic-AMP-dependent transcription factor ATF-3 (ATF3) Target Info
ATF3_HUMAN
miRNA Mature ID hsa-miR-505-5p miRNA Info
miRNA Mature AC
MIMAT0004776
Sequence gggagccaggaaguauugaugu
miRNA Species Homo sapiens
Regulation Mechanism ATF3 was a potential target of miR-505. [1]
Evidence Score (E-score) 1 +
1 Immunohistochemistry [1]
Representative Target(s) Regulated by This miRNA Cyclic-AMP-dependent transcription factor ATF-3 (ATF3) Target Info
ATF3_HUMAN
References  Top
REF 1 miRNA expression pattern associated with prognosis in elderly patients with advanced OPSC and OCC. Int J Oncol. 2013 Sep;43(3):839-49.
REF 2 The expression of miR-30a* and miR-30e* is associated with a dualistic model for grading ovarian papillary serious carcinoma. Int J Oncol. 2014 Jun;44(6):1904-14.
REF 3 A feedback expression of microRNA-590 and activating transcription factor-3 in human breast cancer cells. Int J Biol Macromol. 2015 Jan;72:145-50.
REF 4 miR-590-3p inhibits proliferation and promotes apoptosis by targeting activating transcription factor 3 in human breast cancer cells. Biochimie. 2018 Nov;154:10-18.
REF 5 MicroRNA-494 reduces ATF3 expression and promotes AKI. J Am Soc Nephrol. 2012 Dec;23(12):2012-23.
REF 6 Lysophosphatidic Acid Mediates Activating Transcription Factor 3 Expression Which Is a Target for Post-Transcriptional Silencing by miR-30c-2-3p. PLoS One. 2015 Sep 29;10(9):e0139489.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.