Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T11283 |
Target Info
|
| Target Name |
Mitochondrial matrix protein P1 (HSPD1) |
| Synonyms |
P60 lymphocyte protein; HuCHA60; Hsp60; Heat shock protein 60; HSP-60; Chaperonin 60; CPN60; 60 kDa heat shock protein, mitochondrial; 60 kDa chaperonin |
| Target Type |
Clinical trial Target |
| Gene Name |
HSPD1 |
| Biochemical Class |
Chaperonin ATPase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-1-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uggaauguaaagaaguauguau
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Luciferase Reporter Assay |
[1] |
| 2 |
Western Blot |
[2] |
| Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
|
Brain-derived neurotrophic factor (BDNF)
|
Target Info
|
|
| miRNA Mature ID |
hsa-miR-214-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
acagcaggcacagacaggcagu
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Microarray |
[3] |
| Representative Target(s) Regulated by This miRNA |
Activating transcription factor 4 (ATF-4)
|
Target Info
|
|
|
ADP-ribosylation factor-like protein 2 (ARL2)
|
Target Info
|
|
| References |
Top |
| REF 1 |
The muscle-specific microRNAs miR-1 and miR-133 produce opposing effects on apoptosis by targeting HSP60, HSP70 and caspase-9 in cardiomyocytes. J Cell Sci. 2007 Sep 1;120(Pt 17):3045-52.
|
| REF 2 |
MicroRNA-1-associated effects of neuron-specific brain-derived neurotrophic factor gene deletion in dorsal root ganglia. Mol Cell Neurosci. 2016 Sep;75:36-43.
|
| REF 3 |
MicroRNA-214 is aberrantly expressed in cervical cancers and inhibits the growth of HeLa cells. IUBMB Life. 2009 Nov;61(11):1075-82.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
