Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T08813 |
Target Info
|
| Target Name |
cAMP-dependent protein kinase A type I (PRKAR1A) |
| Synonyms |
cAMP-dependent protein kinase type I-alpha regulatory subunit; Tissue-specific extinguisher 1; TSE1; PRKAR1; PKR1 |
| Target Type |
Literature-reported Target |
| Gene Name |
PRKAR1A |
| Biochemical Class |
Kinase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-155-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uuaaugcuaaucgugauagggguu
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Luciferase Reporter Assay; Western Blot |
[1] |
| 2 |
Reporter Assay |
[2] |
| Representative Target(s) Regulated by This miRNA |
Acetyl-CoA transporter (SLC33A1)
|
Target Info
|
|
|
Angiotensin II receptor type-1 (AGTR1)
|
Target Info
|
|
| miRNA Mature ID |
hsa-miR-1246 |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
aauggauuuuuggagcagg
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR-1246 directly targets PRKAR1A. |
[3] |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Luciferase Reporter Assay; Western Blot |
[3] |
| Representative Target(s) Regulated by This miRNA |
cAMP-dependent protein kinase A type I (PRKAR1A)
|
Target Info
|
|
|
Dual-specificity tyrosine-phosphorylation regulated kinase 1A (DYRK1A)
|
Target Info
|
|
| References |
Top |
| REF 1 |
A functional variant in miR-155 regulation region contributes to lung cancer risk and survival. Oncotarget. 2015 Dec 15;6(40):42781-92.
|
| REF 2 |
Transcriptome and targetome analysis in MIR155 expressing cells using RNA-seq. RNA. 2010 Aug;16(8):1610-22.
|
| REF 3 |
miRNA-1246 induces pro-inflammatory responses in mesenchymal stem/stromal cells by regulating PKA and PP2A. Oncotarget. 2017 Jul 4;8(27):43897-43914.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
