Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T05351 Target Info
Target Name Myristoylated alanine-rich C-kinase substrate (MARCKS)
Synonyms Protein kinase C substrate, 80 kDa protein, light chain; PRKCSL; PKCSL; Myristoylated alaninerich Ckinase substrate; MACS; 80KL protein; 80K-L protein
Target Type Clinical trial Target
Gene Name MARCKS
UniProt ID
P29966
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-21-5p miRNA Info
miRNA Mature AC
MIMAT0000076
Sequence uagcuuaucagacugauguuga
miRNA Species Homo sapiens
Regulation Mechanism The downregulation of miR-21-5p by Anti-miRNA Oligonucleotide resulted in the changed protein level of target MARCKS. [2]
Evidence Score (E-score) 2 +
1 Immunoblot [1]
2 Luciferase Reporter Assay; Western Blot [2]
Representative Target(s) Regulated by This miRNA Apoptosis antigen ligand (CD178) Target Info
TNFL6_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-23b-3p miRNA Info
miRNA Mature AC
MIMAT0000418
Sequence aucacauugccagggauuaccac
miRNA Species Homo sapiens
Regulation Mechanism miR-23b bound directly to the 3'UTR of MARCKS and suppressed its transcription in human embryonic kidney(HEK)293 cells. [3]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [3]
Representative Target(s) Regulated by This miRNA Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
Carbonic anhydrase II (CA-II) Target Info
CAH2_HUMAN
miRNA Mature ID hsa-miR-34c-3p miRNA Info
miRNA Mature AC
MIMAT0004677
Sequence aaucacuaaccacacggccagg
miRNA Species Homo sapiens
Regulation Mechanism MARCKS was a direct target of miR-34c-3p, and the tumor suppressor function of miR-34c-3p may be associate with the downstream gene MARCKS. [4]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [4]
Representative Target(s) Regulated by This miRNA Beta-catenin (CTNNB1) Target Info
CTNB1_HUMAN
Eukaryotic initiation factor 4E (EIF4E) Target Info
IF4E_HUMAN
References  Top
REF 1 MicroRNA-21 Limits Uptake of Listeria monocytogenes by Macrophages to Reduce the Intracellular Niche and Control Infection. Front Cell Infect Microbiol. 2017 May 23;7:201.
REF 2 MicroRNA-21 directly targets MARCKS and promotes apoptosis resistance and invasion in prostate cancer cells. Biochem Biophys Res Commun. 2009 Jun 5;383(3):280-5.
REF 3 Exosomes from bone marrow mesenchymal stem cells contain a microRNA that promotes dormancy in metastatic breast cancer cells. Sci Signal. 2014 Jul 1;7(332):ra63.
REF 4 miR-34c-3p inhibits cell proliferation, migration and invasion of hepatocellular carcinoma by targeting MARCKS. Int J Clin Exp Pathol. 2015 Oct 1;8(10):12728-37.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.