Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T00239 Target Info
Target Name Interleukin-4 (IL4)
Synonyms Pitrakinra; Lymphocyte stimulatory factor 1; IL-4; Binetrakin; BSF-1; B-cell stimulatory factor 1
Target Type Clinical trial Target
Gene Name IL4
Biochemical Class Cytokine: interleukin
UniProt ID
P05112
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-340-5p miRNA Info
miRNA Mature AC
MIMAT0004692
Sequence uuauaaagcaaugagacugauu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Immunohistochemistry; Luciferase Reporter Assay; Western Blot [1]
2 Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
G1/S-specific cyclin-D1 (CCND1) Target Info
CCND1_HUMAN
miRNA Mature ID hsa-miR-429 miRNA Info
miRNA Mature AC
MIMAT0001536
Sequence uaauacugucugguaaaaccgu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Immunohistochemistry; Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
DNA [cytosine-5]-methyltransferase 1 (DNMT1) Target Info
DNMT1_HUMAN
miRNA Mature ID hsa-miR-503-3p miRNA Info
miRNA Mature AC
MIMAT0022925
Sequence gggguauuguuuccgcugccagg
miRNA Species Homo sapiens
Regulation Mechanism The specific inhibition of miR-503 expression remarkably suppressed proliferation and invasion of tumor cells. It can also down-regulated IL-2 and IFN-G expression and facilitate secretion of IL-4 and IL-10. [3]
Evidence Score (E-score) 1 +
1 ELISA [3]
Representative Target(s) Regulated by This miRNA Interleukin-10 (IL10) Target Info
IL10_HUMAN
Interleukin-2 (IL2) Target Info
IL2_HUMAN
References  Top
REF 1 IL-4, a direct target of miR-340/429, is involved in radiation-induced aggressive tumor behavior in human carcinoma cells. Oncotarget. 2016 Dec 27;7(52):86836-86856.
REF 2 Micro-RNA dysregulation in multiple sclerosis favours pro-inflammatory T-cell-mediated autoimmunity. Brain. 2011 Dec;134(Pt 12):3578-89.
REF 3 Effect of miR-503 Down-Regulation on Growth and Invasion of Esophagus Carcinoma and Related Immune Function. Med Sci Monit. 2015 Nov 18;21:3564-9.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.