Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T98459 Target Info
Target Name G2/mitotic-specific cyclin B1 (CCNB1)
Synonyms G2/mitotic-specific cyclin-B1; Cyclin B1; CCNB
Target Type Patented-recorded Target
Gene Name CCNB1
Biochemical Class Eukaryotic nuclear pore complex
UniProt ID
P14635
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-132-3p miRNA Info
miRNA Mature AC
MIMAT0000426
Sequence uaacagucuacagccauggucg
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Western Blot [1]
2 Western Blot; qRT-PCR [2]
Representative Target(s) Regulated by This miRNA Brain-derived neurotrophic factor (BDNF) Target Info
BDNF_HUMAN
Cyclin A2 (CCNA2) Target Info
CCNA2_HUMAN
miRNA Mature ID hsa-miR-212-3p miRNA Info
miRNA Mature AC
MIMAT0000269
Sequence uaacagucuccagucacggcc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Western Blot; qRT-PCR [2]
Representative Target(s) Regulated by This miRNA Acetylcholinesterase (AChE) Target Info
ACES_HUMAN
Adenylate cyclase type 1 (ADCY1) Target Info
ADCY1_HUMAN
miRNA Mature ID hsa-miR-410-3p miRNA Info
miRNA Mature AC
MIMAT0002171
Sequence aauauaacacagauggccugu
miRNA Species Homo sapiens
Regulation Mechanism CCNB1 as target of miRNA-410 since its overexpression reduces CCNB1 at protein and mRNA levels, decreasing cell proliferation. [3]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [3]
Representative Target(s) Regulated by This miRNA Angiotensin II receptor type-1 (AGTR1) Target Info
AGTR1_HUMAN
G2/mitotic-specific cyclin B1 (CCNB1) Target Info
CCNB1_HUMAN
miRNA Mature ID hsa-miR-548b-3p miRNA Info
miRNA Mature AC
MIMAT0003254
Sequence caagaaccucaguugcuuuugu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Immunofluorescence [4]
Representative Target(s) Regulated by This miRNA G2/mitotic-specific cyclin B1 (CCNB1) Target Info
CCNB1_HUMAN
References  Top
REF 1 Identification of key genes, MicroRNAs and potentially regulated pathways in alcoholic hepatitis by integrative analysis. Gene. 2019 Dec 15;720:144035.
REF 2 miR-132 and miR-212 are increased in pancreatic cancer and target the retinoblastoma tumor suppressor. Biochem Biophys Res Commun. 2011 Mar 25;406(4):518-23.
REF 3 Downregulation of miR-410 targeting the cyclin B1 gene plays a role in pituitary gonadotroph tumors. Cell Cycle. 2015;14(16):2590-7.
REF 4 Axl-altered microRNAs regulate tumorigenicity and gefitinib resistance in lung cancer. Cell Death Dis. 2014 May 15;5:e1227.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.