Target Regulator(s) Information (MicroRNA)
Target General Information | Top | ||||
---|---|---|---|---|---|
Target ID | T96760 | Target Info | |||
Target Name | Growth/differentiation factor 5 (GDF-5) | ||||
Synonyms | Radotermin; Lipopolysaccharide-associated protein 4; LPS-associated protein 4; LAP-4; Cartilagederived morphogenetic protein 1; Cartilage-derived morphogenetic protein 1; CDMP1; CDMP-1; Bone morphogenetic protein 14; BMP14; BMP-14 | ||||
Target Type | Clinical trial Target | ||||
Gene Name | GDF5 | ||||
Biochemical Class | Growth factor | ||||
UniProt ID |
The microRNAs (miRNAs) Regulating This Target | Top | ||||
---|---|---|---|---|---|
miRNA Mature ID | hsa-miR-132-3p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | uaacagucuacagccauggucg | ||||
miRNA Species | Homo sapiens | ||||
Evidence Score (E-score) | 2 | + | |||
1 | Luciferase Reporter Assay | [1] | |||
2 | Luciferase Reporter Assay; Western Blot | [2] | |||
Representative Target(s) Regulated by This miRNA | Brain-derived neurotrophic factor (BDNF) | Target Info | |||
Cyclin A2 (CCNA2) | Target Info | ||||
miRNA Mature ID | hsa-miR-21-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | uagcuuaucagacugauguuga | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | GDF-5 is the direct target of miR-21 during the regulation of chondrogenesis. | [3] | |||
Evidence Score (E-score) | 1 | + | |||
1 | Luciferase Reporter Assay; Western Blot | [3] | |||
Representative Target(s) Regulated by This miRNA | Apoptosis antigen ligand (CD178) | Target Info | |||
Apoptosis regulator Bcl-2 (BCL-2) | Target Info | ||||
miRNA Mature ID | hsa-miR-34a-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | uggcagugucuuagcugguugu | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | miR-34a negatively regulates GDF5 expression in NP cells, confirming that GDF5 is a target of miR-34a. | [4] | |||
Evidence Score (E-score) | 1 | + | |||
1 | Luciferase Reporter Assay | [4] | |||
Representative Target(s) Regulated by This miRNA | Amphiregulin (AREG) | Target Info | |||
Androgen receptor (AR) | Target Info |
References | Top | ||||
---|---|---|---|---|---|
REF 1 | MicroRNA-132 upregulation promotes matrix degradation in intervertebral disc degeneration. Exp Cell Res. 2017 Oct 1;359(1):39-49. | ||||
REF 2 | MiR-132-3p Regulates the Osteogenic Differentiation of Thoracic Ligamentum Flavum Cells by Inhibiting Multiple Osteogenesis-Related Genes. Int J Mol Sci. 2016 Aug 20;17(8). pii: E1370. | ||||
REF 3 | MicroRNA-21 controls the development of osteoarthritis by targeting GDF-5 in chondrocytes. Exp Mol Med. 2014 Feb 28;46:e79. | ||||
REF 4 | Inhibition of microRNA-34a prevents IL-1-induced extracellular matrix degradation in nucleus pulposus by increasing GDF5 expression. Exp Biol Med (Maywood). 2016 Nov;241(17):1924-1932. |
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.