Target Regulator(s) Information (MicroRNA)
| Target General Information | Top | ||||
|---|---|---|---|---|---|
| Target ID | T96396 | Target Info | |||
| Target Name | Prohibitin (PHB) | ||||
| Synonyms | PHB1; HEL-S-54e; HEL-215 | ||||
| Target Type | Literature-reported Target | ||||
| Gene Name | PHB | ||||
| UniProt ID | |||||
| The microRNAs (miRNAs) Regulating This Target | Top | ||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-27a-3p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | uucacaguggcuaaguuccgc | ||||
| miRNA Species | Homo sapiens | ||||
| Evidence Score (E-score) | 5 | + | |||
| 1 | Luciferase Reporter Assay | [1] | |||
| 2 | Luciferase Reporter Assay | [2] | |||
| 3 | Luciferase Reporter Assay | [3] | |||
| 4 | Luciferase Reporter Assay; Microarray; qRT-PCR | [4] | |||
| 5 | Luciferase Reporter Assay; Northern Blot; qRT-PCR; Western Blot | [5] | |||
| Representative Target(s) Regulated by This miRNA | ATP-binding cassette transporter A1 (ABCA1) | Target Info | |||
| Cellular tumor antigen p53 (TP53) | Target Info | ||||
| miRNA Mature ID | hsa-miR-27b-3p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | uucacaguggcuaaguucugc | ||||
| miRNA Species | Homo sapiens | ||||
| Regulation Mechanism | miR-27 is an anti-adipogenic microRNA partly by targeting PHB and impairing mitochondrial function. | [2] | |||
| Evidence Score (E-score) | 1 | + | |||
| 1 | Luciferase Reporter Assay | [2] | |||
| Representative Target(s) Regulated by This miRNA | Adenosine A2b receptor (ADORA2B) | Target Info | |||
| Albendazole monooxygenase (CYP3A4) | Target Info | ||||
| References | Top | ||||
|---|---|---|---|---|---|
| REF 1 | Emerging role of microRNA-27a in human malignant glioma cell survival via targeting of prohibitin. Mol Med Rep. 2015 Jul;12(1):1515-23. | ||||
| REF 2 | MicroRNA-27 (miR-27) targets prohibitin and impairs adipocyte differentiation and mitochondrial function in human adipose-derived stem cells. J Biol Chem. 2013 Nov 29;288(48):34394-402. | ||||
| REF 3 | MicroRNA-27a functions as an oncogene in gastric adenocarcinoma by targeting prohibitin. Cancer Lett. 2009 Jan 18;273(2):233-42. | ||||
| REF 4 | MicroRNA-27a Contributes to Rhabdomyosarcoma Cell Proliferation by Suppressing RARA and RXRA. PLoS One. 2015 Apr 27;10(4):e0125171. | ||||
| REF 5 | Androgen-regulated processing of the oncomir miR-27a, which targets Prohibitin in prostate cancer. Hum Mol Genet. 2012 Jul 15;21(14):3112-27. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.