Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T94085 |
Target Info
|
| Target Name |
Retinoic acid receptor alpha (RARA) |
| Synonyms |
RAR-alpha; RAR alpha; Nuclear receptor subfamily 1 group B member 1; NR1B1 |
| Target Type |
Clinical trial Target |
| Gene Name |
RARA |
| Biochemical Class |
Nuclear hormone receptor |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-27a-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uucacaguggcuaaguuccgc
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Luciferase Reporter Assay |
[1] |
| 2 |
Western Blot |
[2] |
| Representative Target(s) Regulated by This miRNA |
ATP-binding cassette transporter A1 (ABCA1)
|
Target Info
|
|
|
Cellular tumor antigen p53 (TP53)
|
Target Info
|
|
| miRNA Mature ID |
hsa-miR-125a-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
ucccugagacccuuuaaccuguga
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Northern Blot |
[3] |
| Representative Target(s) Regulated by This miRNA |
Apoptosis regulator BAK (BAK)
|
Target Info
|
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
| References |
Top |
| REF 1 |
MicroRNA-27a Contributes to Rhabdomyosarcoma Cell Proliferation by Suppressing RARA and RXRA. PLoS One. 2015 Apr 27;10(4):e0125171.
|
| REF 2 |
Transcriptional suppression of microRNA-27a contributes to laryngeal cancer differentiation via GSK-3-involved Wnt/-catenin pathway. Oncotarget. 2017 Feb 28;8(9):14708-14718.
|
| REF 3 |
Comprehensive analysis of microRNA expression patterns in hepatocellular carcinoma and non-tumorous tissues. Oncogene. 2006 Apr 20;25(17):2537-45.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
