Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T93903 |
Target Info
|
| Target Name |
Caspase-9 (CASP9) |
| Synonyms |
MCH6; ICE-like apoptotic protease 6; ICE-LAP6; CASP-9; Apoptotic protease-activating factor 3; Apoptotic protease activating factor 3; Apoptotic protease Mch-6; APAF-3 |
| Target Type |
Clinical trial Target |
| Gene Name |
CASP9 |
| Biochemical Class |
Peptidase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-133a-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uuugguccccuucaaccagcug
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
The overexpression of miR-133a-3p by mature miRNA transfection resulted in the changed mRNA level of CASP9; The Underexpression by Anti-miRNA Oligonucleotides resulted in the increased protein level of target CASP9. |
[1] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Luciferase Reporter Assay |
[1] |
| 2 |
Western Blot |
[2] |
| Representative Target(s) Regulated by This miRNA |
Caspase-9 (CASP9)
|
Target Info
|
|
|
Fascin (FSCN1)
|
Target Info
|
|
| miRNA Mature ID |
hsa-miR-582-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uuacaguuguucaaccaguuacu
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR-582-5p is shown to directly target Caspase 9. |
[3] |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Luciferase Reporter Assay; Western Blot |
[3] |
| Representative Target(s) Regulated by This miRNA |
Caspase-3 (CASP3)
|
Target Info
|
|
|
Caspase-9 (CASP9)
|
Target Info
|
|
| References |
Top |
| REF 1 |
The muscle-specific microRNAs miR-1 and miR-133 produce opposing effects on apoptosis by targeting HSP60, HSP70 and caspase-9 in cardiomyocytes. J Cell Sci. 2007 Sep 1;120(Pt 17):3045-52.
|
| REF 2 |
Tanshinone IIA ameliorates apoptosis of myocardiocytes by up-regulation of miR-133 and suppression of Caspase-9. Eur J Pharmacol. 2017 Nov 15;815:343-350.
|
| REF 3 |
Novel anti-apoptotic microRNAs 582-5p and 363 promote human glioblastoma stem cell survival via direct inhibition of caspase 3, caspase 9, and Bim. PLoS One. 2014 May 7;9(5):e96239.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
