Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T93278 Target Info
Target Name Mannose receptor (MRC1)
Synonyms Macrophage mannose receptor 1like protein 1; Macrophage mannose receptor 1-like protein 1; Macrophage mannose receptor 1; MRC1L1; MMR; Human mannose receptor; Ctype lectin domain family 13 member Dlike; Ctype lectin domain family 13 member D; CLEC13DL; CLEC13D; CD206; C-type lectin domain family 13 member D-like; C-type lectin domain family 13 member D
Target Type Literature-reported Target
Gene Name MRC1
Biochemical Class Fibronectin protein
UniProt ID
P22897
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-27a-3p miRNA Info
miRNA Mature AC
MIMAT0000084
Sequence uucacaguggcuaaguuccgc
miRNA Species Homo sapiens
Regulation Mechanism miR-27a modulated the process of phagocytosis by targeting MRC1 expression on monocytes. [1]
Evidence Score (E-score) 1 +
1 ELISA; Western Blot [1]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
References  Top
REF 1 MicroRNA Cargo of Extracellular Vesicles from Alcohol-exposed Monocytes Signals Naive Monocytes to Differentiate into M2 Macrophages. J Biol Chem. 2016 Jan 1;291(1):149-59.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.