Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T92834 |
Target Info
|
| Target Name |
Amphiregulin (AREG) |
| Synonyms |
SDGF; Colorectum cellderived growth factor; Colorectum cell-derived growth factor; CRDGF; AREGB; AR |
| Target Type |
Literature-reported Target |
| Gene Name |
AREG |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-34a-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uggcagugucuuagcugguugu
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Microarray |
[1] |
| 2 |
qRT-PCR; Western Blot; Luciferase Report Assay |
[2] |
| Representative Target(s) Regulated by This miRNA |
Amphiregulin (AREG)
|
Target Info
|
|
|
Androgen receptor (AR)
|
Target Info
|
|
| miRNA Mature ID |
hsa-miR-200a-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uaacacugucugguaacgaugu
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
AREG are transcriptionally or post-transcriptionally regulated by the miR-200. |
[3] |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
ELISA; Luciferase Reporter Assay; Western Blot |
[3] |
| Representative Target(s) Regulated by This miRNA |
Amphiregulin (AREG)
|
Target Info
|
|
|
Beta-catenin (CTNNB1)
|
Target Info
|
|
| References |
Top |
| REF 1 |
MicroRNA profiling in mucosal biopsies of eosinophilic esophagitis patients pre and post treatment with steroids and relationship with mRNA targets. PLoS One. 2012;7(7):e40676.
|
| REF 2 |
MiR-34a suppresses amphiregulin and tumor metastatic potential of head and neck squamous cell carcinoma (HNSCC). Oncotarget. 2015 Apr 10;6(10):7454-69.
|
| REF 3 |
ZEB1 sensitizes lung adenocarcinoma to metastasis suppression by PI3K antagonism. J Clin Invest. 2014 Jun;124(6):2696-708.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
