Content Navigation
( All
None )
Target General Information |
Top |
Target ID |
T91906 |
Target Info
|
Target Name |
ETS domain-containing protein Elk-3 (ELK3) |
Synonyms |
Serum response factor accessory protein 2; SRF accessory protein 2; SAP2; SAP-2; ETS-related protein NET; ETS-related protein ERP |
Target Type |
Literature-reported Target |
Gene Name |
ELK3 |
Biochemical Class |
E26 transformation-specific ETS |
UniProt ID |
|
The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-124-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uaaggcacgcggugaaugcc
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[1] |
Representative Target(s) Regulated by This miRNA |
Beta-secretase 1 (BACE1)
|
Target Info
|
|
Brain-derived neurotrophic factor (BDNF)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-210-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
cugugcgugugacagcggcuga
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Immunoprecipitation |
[1] |
Representative Target(s) Regulated by This miRNA |
Activin receptor type IB (ACVR1B)
|
Target Info
|
|
Autophagy-related protein 7 (ATG7)
|
Target Info
|
|
References |
Top |
REF 1 |
An integrated approach for experimental target identification of hypoxia-induced miR-210. J Biol Chem. 2009 Dec 11;284(50):35134-43.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.