Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T91761 |
Target Info
|
| Target Name |
T-cell-specific kinase (ITK) |
| Synonyms |
Tyrosine kinase ITK; Inducible T cell kinase; EMT |
| Target Type |
Clinical trial Target |
| Gene Name |
ITK |
| Biochemical Class |
Kinase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-155-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uuaaugcuaaucgugauagggguu
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
Overexpressed miR-155 decreases itk mRNA expression that may influence T cell activation. |
[2] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Luciferase Reporter Assay |
[1] |
| 2 |
qRT-PCR |
[2] |
| Representative Target(s) Regulated by This miRNA |
Acetyl-CoA transporter (SLC33A1)
|
Target Info
|
|
|
Angiotensin II receptor type-1 (AGTR1)
|
Target Info
|
|
| References |
Top |
| REF 1 |
Regulated Expression of miR-155 is Required for iNKT Cell Development. Front Immunol. 2015 Mar 30;6:140.
|
| REF 2 |
TGF- conditions intestinal T cells to express increased levels of miR-155, associated with down-regulation of IL-2 and itk mRNA. Mucosal Immunol. 2013 Jan;6(1):167-76.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
