Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T90439 Target Info
Target Name Jagged-2 protein (JAG2)
Synonyms hJ2; Protein jagged-2; Jagged2
Target Type Literature-reported Target
Gene Name JAG2
UniProt ID
Q9Y219
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-410-3p miRNA Info
miRNA Mature AC
MIMAT0002171
Sequence aauauaacacagauggccugu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Immunofluorescence; Western Blot [1]
Representative Target(s) Regulated by This miRNA Angiotensin II receptor type-1 (AGTR1) Target Info
AGTR1_HUMAN
G2/mitotic-specific cyclin B1 (CCNB1) Target Info
CCNB1_HUMAN
References  Top
REF 1 Tangeretin enhances radiosensitivity and inhibits the radiation-induced epithelial-mesenchymal transition of gastric cancer cells. Oncol Rep. 2015 Jul;34(1):302-10.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.