Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T90360 Target Info
Target Name Gamma-synuclein (SNCG)
Synonyms Synoretin; Persyn; PRSN; Breast cancer-specific gene 1 protein; BCSG1
Target Type Literature-reported Target
Gene Name SNCG
Biochemical Class Synuclein
UniProt ID
O76070
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-107 miRNA Info
miRNA Mature AC
MIMAT0000104
Sequence agcagcauuguacagggcuauca
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Beta-secretase 1 (BACE1) Target Info
BACE1_HUMAN
Caveolin 1 (CAV1) Target Info
CAV1_HUMAN
miRNA Mature ID hsa-miR-4437 miRNA Info
miRNA Mature AC
MIMAT0018953
Sequence ugggcucaggguacaaagguu
miRNA Species Homo sapiens
Regulation Mechanism Expression of miR-4437 for which putative targets in 3'UTR is predicted caused a 61.2% reduction of endogenous c-synuclein expression confirming their role in gene expression regulation. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Gamma-synuclein (SNCG) Target Info
SYUG_HUMAN
miRNA Mature ID hsa-miR-4674 miRNA Info
miRNA Mature AC
MIMAT0019756
Sequence cugggcucgggacgcgcggcu
miRNA Species Homo sapiens
Regulation Mechanism Expression of miR-4674 for which putative targets in 3'UTR is predicted caused a 60.1% reduction of endogenous c-synuclein expression confirming their role in gene expression regulation. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Gamma-synuclein (SNCG) Target Info
SYUG_HUMAN
miRNA Mature ID hsa-miR-4722-5p miRNA Info
miRNA Mature AC
MIMAT0019836
Sequence ggcaggagggcugugccagguug
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Gamma-synuclein (SNCG) Target Info
SYUG_HUMAN
References  Top
REF 1 Cell-specific post-transcriptional regulation of -synuclein gene by micro-RNAs. PLoS One. 2013 Sep 11;8(9):e73786.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.