miRNA Details
miRNA General Information | |||||
---|---|---|---|---|---|
miRNA Mature ID | hsa-miR-4437 | ||||
miRNA Stemloop AC | MI0016778 | ||||
miRNA Stemloop ID | hsa-mir-4437 | ||||
Sequence | ugggcucaggguacaaagguu | ||||
TTD Target(s) Regulated by This miRNA | Gamma-synuclein (SNCG) | Literature-reported Target | Target Info | [1] | |
References | |||||
REF 1 | Cell-specific post-transcriptional regulation of -synuclein gene by micro-RNAs. PLoS One. 2013 Sep 11;8(9):e73786. |
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.