miRNA General Information
miRNA Mature ID	hsa-miR-4674
miRNA Stemloop AC	MI0017305
miRNA Stemloop ID	hsa-mir-4674
Sequence	cugggcucgggacgcgcggcu
TTD Target(s) Regulated by This miRNA	Gamma-synuclein (SNCG)	Literature-reported Target	Target Info	[1]
References
REF 1	Cell-specific post-transcriptional regulation of -synuclein gene by micro-RNAs. PLoS One. 2013 Sep 11;8(9):e73786.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.