Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T88656 Target Info
Target Name Notch-2 receptor (NOTCH2)
Synonyms hN2; Notch 2 intracellular domain; Notch 2; Neurogenic locus notch homolog protein 2
Target Type Clinical trial Target
Gene Name NOTCH2
Biochemical Class Notch protein
UniProt ID
Q04721
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-107 miRNA Info
miRNA Mature AC
MIMAT0000104
Sequence agcagcauuguacagggcuauca
miRNA Species Homo sapiens
Regulation Mechanism miR-107 downregulates Notch-2 protein levels by binding its UTR. [3]
Evidence Score (E-score) 3 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [1]
2 qRT-PCR; Western Blot [2]
3 Western Blot [3]
Representative Target(s) Regulated by This miRNA Beta-secretase 1 (BACE1) Target Info
BACE1_HUMAN
Caveolin 1 (CAV1) Target Info
CAV1_HUMAN
miRNA Mature ID hsa-miR-146a-5p miRNA Info
miRNA Mature AC
MIMAT0000449
Sequence ugagaacugaauuccauggguu
miRNA Species Homo sapiens
Regulation Mechanism NOTCH2 was a target gene of miR-146a. [6]
Evidence Score (E-score) 3 +
1 Luciferase Reporter Assay [4]
2 Luciferase Reporter Assay; Western Blot [5]
3 Luciferase Reporter Assay; Western Blot [6]
Representative Target(s) Regulated by This miRNA Activation B7-1 antigen (CD80) Target Info
CD80_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-34a-5p miRNA Info
miRNA Mature AC
MIMAT0000255
Sequence uggcagugucuuagcugguugu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-34a-5p by mature miRNA precursor transfection resulted in the decreased protein level of target NOTCH2. [8]
Evidence Score (E-score) 2 +
1 Immunoblot; Immunocytochemistry; Luciferase Reporter Assay; Microarray; qRT-PCR; Western Blot [7]
2 Immunoblot; Immunocytochemistry; Luciferase Reporter Assay; Microarray; qRT-PCR; Western Blot [8]
Representative Target(s) Regulated by This miRNA Amphiregulin (AREG) Target Info
AREG_HUMAN
Androgen receptor (AR) Target Info
ANDR_HUMAN
miRNA Mature ID hsa-miR-181c-5p miRNA Info
miRNA Mature AC
MIMAT0000258
Sequence aacauucaaccugucggugagu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [9]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Bone morphogenetic protein receptor (BMPR2) Target Info
BMPR2_HUMAN
miRNA Mature ID hsa-miR-191-5p miRNA Info
miRNA Mature AC
MIMAT0000440
Sequence caacggaaucccaaaagcagcug
miRNA Species Homo sapiens
Regulation Mechanism NOTCH2 is a target of miR-191. [10]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [10]
Representative Target(s) Regulated by This miRNA CCAAT/enhancer binding protein beta (CEBPB) Target Info
CEBPB_HUMAN
Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
miRNA Mature ID hsa-miR-23b-3p miRNA Info
miRNA Mature AC
MIMAT0000418
Sequence aucacauugccagggauuaccac
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [11]
Representative Target(s) Regulated by This miRNA Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
Carbonic anhydrase II (CA-II) Target Info
CAH2_HUMAN
miRNA Mature ID hsa-miR-326 miRNA Info
miRNA Mature AC
MIMAT0000756
Sequence ccucugggcccuuccuccag
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Western Blot; Luciferase Reporter Assay [12]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-xL (BCL-xL) Target Info
B2CL1_HUMAN
Fascin (FSCN1) Target Info
FSCN1_HUMAN
References  Top
REF 1 MicroRNA-107 inhibits glioma cell migration and invasion by modulating Notch2 expression. J Neurooncol. 2013 Mar;112(1):59-66.
REF 2 MicroRNA-107 inhibits U87 glioma stem cells growth and invasion. Cell Mol Neurobiol. 2013 Jul;33(5):651-7.
REF 3 P53-induced microRNA-107 inhibits proliferation of glioma cells and down-regulates the expression of CDK6 and Notch-2. Neurosci Lett. 2013 Feb 8;534:327-32.
REF 4 Mechanism of MicroRNA-146a/Notch2 Signaling Regulating IL-6 in Graves Ophthalmopathy. Cell Physiol Biochem. 2017;41(4):1285-1297.
REF 5 miR-146a-5p mediates epithelial-mesenchymal transition of oesophageal squamous cell carcinoma via targeting Notch2. Br J Cancer. 2016 Dec 6;115(12):1548-1554.
REF 6 A functional polymorphism in the preiR 46a gene influences the prognosis of glioblastoma multiforme by interfering with the balance between Notch1 and Notch2. Mol Med Rep. 2015 Oct;12(4):5475-81.
REF 7 Hypoxia-induced down-regulation of microRNA-34a promotes EMT by targeting the Notch signaling pathway in tubular epithelial cells. PLoS One. 2012;7(2):e30771.
REF 8 MicroRNA-34a inhibits glioblastoma growth by targeting multiple oncogenes. Cancer Res. 2009 Oct 1;69(19):7569-76.
REF 9 Involvement of epigenetically silenced microRNA-181c in gastric carcinogenesis. Carcinogenesis. 2010 May;31(5):777-84.
REF 10 MiR-191 Regulates Primary Human Fibroblast Proliferation and Directly Targets Multiple Oncogenes. PLoS One. 2015 May 20;10(5):e0126535.
REF 11 The reciprocal regulation loop of Notch2 pathway and miR-23b in controlling gastric carcinogenesis. Oncotarget. 2015 Jul 20;6(20):18012-26.
REF 12 The neuronal microRNA miR-326 acts in a feedback loop with notch and has therapeutic potential against brain tumors. J Neurosci. 2009 Dec 2;29(48):15161-8.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.