Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T85221 Target Info
Target Name Glucose-6-phosphatase (G6PC)
Synonyms Glucose-6-phosphatase alpha; G6Pase-alpha; G6Pase; G6PT; G-6-Pase
Target Type Clinical trial Target
Gene Name G6PC
Biochemical Class Phosphoric monoester hydrolase
UniProt ID
P35575
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-23a-3p miRNA Info
miRNA Mature AC
MIMAT0000078
Sequence aucacauugccagggauuucc
miRNA Species Homo sapiens
Regulation Mechanism G6PC is a direct target of miR-23a. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
DNA topoisomerase I (TOP1) Target Info
TOP1_HUMAN
miRNA Mature ID hsa-miR-33b-5p miRNA Info
miRNA Mature AC
MIMAT0003301
Sequence gugcauugcuguugcauugc
miRNA Species Homo sapiens
Regulation Mechanism miR-33b binds to the 3'UTR of G6PC and significantly repressed G6PC 3'UTR activities. [2]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
References  Top
REF 1 Stat3-mediated activation of microRNA-23a suppresses gluconeogenesis in hepatocellular carcinoma by down-regulating glucose-6-phosphatase and peroxisome proliferator-activated receptor gamma, coactivator 1 alpha. Hepatology. 2012 Jul;56(1):186-97.
REF 2 MicroRNA 33 regulates glucose metabolism. Mol Cell Biol. 2013 Aug;33(15):2891-902.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.