Content Navigation
( All
None )
Target General Information |
Top |
Target ID |
T84560 |
Target Info
|
Target Name |
Mitochondrial uncoupling protein 2 (UCP2) |
Synonyms |
UCPH; UCP 2; Solute carrier family 25 member 8; SLC25A8 |
Target Type |
Clinical trial Target |
Gene Name |
UCP2 |
Biochemical Class |
Mitochondrial carrier |
UniProt ID |
|
The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-15a-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uagcagcacauaaugguuugug
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-15a directly targeted and inhibited uncoupling protein-2 (UCP-2) gene expression. |
[1] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[1] |
Representative Target(s) Regulated by This miRNA |
Amyloid beta A4 protein (APP)
|
Target Info
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
References |
Top |
REF 1 |
MicroRNA-15a positively regulates insulin synthesis by inhibiting uncoupling protein-2 expression. Diabetes Res Clin Pract. 2011 Jan;91(1):94-100.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.