Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T84341 Target Info
Target Name Hepatoma-derived growth factor (HDGF)
Synonyms High-mobility group protein 1-like 2; High mobility group protein 1-like 2; HMG1L2; HMG-1L2
Target Type Literature-reported Target
Gene Name HDGF
UniProt ID
P51858
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-141-3p miRNA Info
miRNA Mature AC
MIMAT0000432
Sequence uaacacugucugguaaagaugg
miRNA Species Homo sapiens
Regulation Mechanism miR-141 was negatively correlated with miR-141 in GC tissues. [1]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [1]
2 RT-PCR [2]
Representative Target(s) Regulated by This miRNA Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
Bromodomain-containing protein 3 (BRD3) Target Info
BRD3_HUMAN
miRNA Mature ID hsa-miR-214-3p miRNA Info
miRNA Mature AC
MIMAT0000271
Sequence acagcaggcacagacaggcagu
miRNA Species Homo sapiens
Regulation Mechanism Ectopic expression of miR-214 significantly suppressed luciferase activity in cells transfected with the wild type putative target sequences of HDGF. [3]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [3]
2 Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA Activating transcription factor 4 (ATF-4) Target Info
ATF4_HUMAN
ADP-ribosylation factor-like protein 2 (ARL2) Target Info
ARL2_HUMAN
miRNA Mature ID hsa-miR-497-5p miRNA Info
miRNA Mature AC
MIMAT0002820
Sequence cagcagcacacugugguuugu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [4]
2 PAR-CLIP [5]
Representative Target(s) Regulated by This miRNA Angiomotin (AMOT) Target Info
AMOT_HUMAN
Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
miRNA Mature ID hsa-miR-610 miRNA Info
miRNA Mature AC
MIMAT0003278
Sequence ugagcuaaaugugugcuggga
miRNA Species Homo sapiens
Regulation Mechanism miR-610 down regulates HDGF expression by directly targeting its 3'UTR. [6]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [6]
Representative Target(s) Regulated by This miRNA Hepatoma-derived growth factor (HDGF) Target Info
HDGF_HUMAN
Ubiquitin-protein ligase E3 Mdm2 (MDM2) Target Info
MDM2_HUMAN
References  Top
REF 1 miR-141 suppresses proliferation and motility of gastric cancer cells by targeting HDGF. Mol Cell Biochem. 2014 Mar;388(1-2):211-8.
REF 2 Tumor-suppressing miR-141 gene complex-loaded tissue-adhesive glue for the locoregional treatment of hepatocellular carcinoma. Theranostics. 2018 Jun 24;8(14):3891-3901.
REF 3 MicroRNA-214 downregulation contributes to tumor angiogenesis by inducing secretion of the hepatoma-derived growth factor in human hepatoma. J Hepatol. 2012 Sep;57(3):584-91.
REF 4 Downregulation of miR-497 promotes tumor growth and angiogenesis by targeting HDGF in non-small cell lung cancer. Biochem Biophys Res Commun. 2013 Jun 7;435(3):466-71.
REF 5 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
REF 6 MiR-610 inhibits cell proliferation and invasion in colorectal cancer by repressing hepatoma-derived growth factor. Am J Cancer Res. 2015 Nov 15;5(12):3635-44.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.