Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T82383 Target Info
Target Name Tyrosine-protein kinase UFO (AXL)
Synonyms UFO; Tyrosine-protein kinase receptor UFO; AXL oncogene
Target Type Successful Target
Gene Name AXL
Biochemical Class Kinase
UniProt ID
P30530
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-34a-5p miRNA Info
miRNA Mature AC
MIMAT0000255
Sequence uggcagugucuuagcugguugu
miRNA Species Homo sapiens
Regulation Mechanism miR-34a that is unique to the targeting site within AXL. [4]
Evidence Score (E-score) 4 +
1 ChIP; Luciferase Reporter Assay; Microarray; qRT-PCR; Western Blot [1]
2 Luciferase Reporter Assay; qRT-PCR [2]
3 Luciferase Reporter Assay; qRT-PCR; Western Blot [3]
4 Reporter Assay [4]
Representative Target(s) Regulated by This miRNA Amphiregulin (AREG) Target Info
AREG_HUMAN
Androgen receptor (AR) Target Info
ANDR_HUMAN
miRNA Mature ID hsa-miR-34c-5p miRNA Info
miRNA Mature AC
MIMAT0000686
Sequence aggcaguguaguuagcugauugc
miRNA Species Homo sapiens
Regulation Mechanism Downregulation in luciferase signal with miR-34c is due to binding of miR-34c to the target site in the AXL 3'UTR. [2]
Evidence Score (E-score) 2 +
1 ChIP; Luciferase Reporter Assay; Microarray; qRT-PCR; Western Blot [1]
2 Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Cyclin-dependent kinase 4 (CDK4) Target Info
CDK4_HUMAN
miRNA Mature ID hsa-miR-122-5p miRNA Info
miRNA Mature AC
MIMAT0000421
Sequence uggagugugacaaugguguuug
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [5]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
Apoptosis regulator Bcl-xL (BCL-xL) Target Info
B2CL1_HUMAN
References  Top
REF 1 Negative feedback regulation of AXL by miR-34a modulates apoptosis in lung cancer cells. RNA. 2016 Feb;22(2):303-15.
REF 2 The Axl-Regulating Tumor Suppressor miR-34a Is Increased in ccRCC but Does Not Correlate with Axl mRNA or Axl Protein Levels. PLoS One. 2015 Aug 19;10(8):e0135991.
REF 3 Identification of the receptor tyrosine kinase AXL in breast cancer as a target for the human miR-34a microRNA. Breast Cancer Res Treat. 2011 Nov;130(2):663-79.
REF 4 Genome-wide characterization of miR-34a induced changes in protein and mRNA expression by a combined pulsed SILAC and microarray analysis. Mol Cell Proteomics. 2011 Aug;10(8):M111.010462.
REF 5 Hepatic loss of miR-122 predisposes mice to hepatobiliary cyst and hepatocellular carcinoma upon diethylnitrosamine exposure. Am J Pathol. 2013 Dec;183(6):1719-1730.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.