Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T82254 Target Info
Target Name Apoptosis regulator BAK (BAK)
Synonyms CDN1; Bcl2like protein 7; Bcl2L7; Bcl2-L-7; Bcl2 homologous antagonist/killer; Bcl-2-like protein 7; Bcl-2 homologous antagonist/killer
Target Type Literature-reported Target
Gene Name BAK1
Biochemical Class B-cell lymphoma Bcl-2
UniProt ID
Q16611
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-125b-5p miRNA Info
miRNA Mature AC
MIMAT0000423
Sequence ucccugagacccuaacuuguga
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-125b-5p by mature miRNA mimics tranfection resulted in the decreased protein level of target BAK1; The Underexpression by Anti-miRNA Oligonucleotides resulted in the increased protein level of target BAK1. [2]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [1]
2 Western Blot; qRT-PCR; Microarray; Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Apoptosis regulator BAK (BAK) Target Info
BAK_HUMAN
Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
miRNA Mature ID hsa-miR-125a-5p miRNA Info
miRNA Mature AC
MIMAT0000443
Sequence ucccugagacccuuuaaccuguga
miRNA Species Homo sapiens
Regulation Mechanism miR-125a inhibits immature hematopoietic cell apoptosis and targets Bak1. [3]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA Apoptosis regulator BAK (BAK) Target Info
BAK_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
References  Top
REF 1 MicroRNA-125b confers the resistance of breast cancer cells to paclitaxel through suppression of pro-apoptotic Bcl-2 antagonist killer 1 (Bak1) exp... J Biol Chem. 2010 Jul 9;285(28):21496-507.
REF 2 An androgen-regulated miRNA suppresses Bak1 expression and induces androgen-independent growth of prostate cancer cells. Proc Natl Acad Sci U S A. 2007 Dec 11;104(50):19983-8.
REF 3 MicroRNA miR-125a controls hematopoietic stem cell number. Proc Natl Acad Sci U S A. 2010 Aug 10;107(32):14229-34.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.