Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T80306 Target Info
Target Name S-phase kinase-associated protein 2 (SKP2)
Synonyms Skp2; P45skp2; FBXL1; F-box/LRR-repeat protein 1; F-box protein Skp2; Cyclin-A/CDK2-associated protein p45; Cyclin A/CDK2-associated protein p45; Cyclin A/CDK2-associated p45
Target Type Literature-reported Target
Gene Name SKP2
UniProt ID
Q13309
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-30a-5p miRNA Info
miRNA Mature AC
MIMAT0000087
Sequence uguaaacauccucgacuggaag
miRNA Species Homo sapiens
Regulation Mechanism SKP2 is a direct target of miR-30a. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Beclin-1 (BECN1) Target Info
BECN1_HUMAN
Brain-derived neurotrophic factor (BDNF) Target Info
BDNF_HUMAN
miRNA Mature ID hsa-miR-340-5p miRNA Info
miRNA Mature AC
MIMAT0004692
Sequence uuauaaagcaaugagacugauu
miRNA Species Homo sapiens
Regulation Mechanism SKP2 expression was almost completely suppressed in response to the miRNA overexpression, and significantly upregulated in response to the anti-miR-340. [2]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [2]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
G1/S-specific cyclin-D1 (CCND1) Target Info
CCND1_HUMAN
miRNA Mature ID hsa-miR-3163 miRNA Info
miRNA Mature AC
MIMAT0015037
Sequence uauaaaaugagggcaguaagac
miRNA Species Homo sapiens
Regulation Mechanism miR-3163 bound to 3'UTR of SKP2 mRNA in NSCLC cells to inhibit its translation. [3]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [3]
Representative Target(s) Regulated by This miRNA DNA mismatch repair protein MSH2 (MSH2) Target Info
MSH2_HUMAN
S-phase kinase-associated protein 2 (SKP2) Target Info
SKP2_HUMAN
References  Top
REF 1 The miR-30 Family Inhibits Pulmonary Vascular Hyperpermeability in the Premetastatic Phase by Direct Targeting of Skp2. Clin Cancer Res. 2015 Jul 1;21(13):3071-80.
REF 2 miR-340 inhibits tumor cell proliferation and induces apoptosis by targeting multiple negative regulators of p27 in non-small cell lung cancer. Oncogene. 2015 Jun;34(25):3240-50.
REF 3 Skp2 regulates non-small cell lung cancer cell growth by Meg3 and miR-3163. Tumour Biol. 2016 Mar;37(3):3925-31.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.