The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-155-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uuaaugcuaaucgugauagggguu
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Reporter Assay |
[1] |
Representative Target(s) Regulated by This miRNA |
Acetyl-CoA transporter (SLC33A1)
|
Target Info
|
|
Angiotensin II receptor type-1 (AGTR1)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-221-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
agcuacauugucugcuggguuuc
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[2] |
Representative Target(s) Regulated by This miRNA |
Bcl-2-binding component 3 (BBC3)
|
Target Info
|
|
Beclin-1 (BECN1)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-222-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
agcuacaucuggcuacugggu
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[2] |
Representative Target(s) Regulated by This miRNA |
AN1-type zinc finger protein 5 (ZFAND5)
|
Target Info
|
|
ATP-binding cassette transporter G2 (ABCG2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-338-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uccagcaucagugauuuuguug
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
Oncogene SSX2IP is a target of miR-338-3p. |
[3] |
Evidence Score (E-score) |
1 |
+ |
1 |
Immunohistochemistry; Luciferase Reporter Assay; Western Blot |
[3] |
Representative Target(s) Regulated by This miRNA |
G1/S-specific cyclin-D1 (CCND1)
|
Target Info
|
|
Hypoxia-inducible factor 1 alpha (HIF-1A)
|
Target Info
|
|