Target Regulator(s) Information (MicroRNA)
| Target General Information | Top | ||||
|---|---|---|---|---|---|
| Target ID | T75643 | Target Info | |||
| Target Name | Pattern recognition receptor NOD2 (NOD2) | ||||
| Synonyms | Nucleotidebinding oligomerization domaincontaining protein 2; Nucleotide-binding oligomerization domain-containing protein 2; Inflammatory bowel disease protein 1; IBD1; Caspase recruitment domaincontaining protein 15; Caspase recruitment domain-containing protein 15; CARD15 | ||||
| Target Type | Clinical trial Target | ||||
| Gene Name | NOD2 | ||||
| UniProt ID | |||||
| The microRNAs (miRNAs) Regulating This Target | Top | ||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-122-5p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | uggagugugacaaugguguuug | ||||
| miRNA Species | Homo sapiens | ||||
| Regulation Mechanism | miR-122 and its target gene NOD2 may play an important role in the injury of intestinal epithelial cells induced by LPS. | [2] | |||
| Evidence Score (E-score) | 2 | + | |||
| 1 | Luciferase Reporter Assay | [1] | |||
| 2 | Luciferase Reporter Assay; Western Blot | [2] | |||
| Representative Target(s) Regulated by This miRNA | Apoptosis regulator Bcl-W (BCL-W) | Target Info | |||
| Apoptosis regulator Bcl-xL (BCL-xL) | Target Info | ||||
| miRNA Mature ID | hsa-miR-10a-5p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | uacccuguagauccgaauuugug | ||||
| miRNA Species | Homo sapiens | ||||
| Regulation Mechanism | miR-10a specifically downregulates NOD2 expression. | [3] | |||
| Evidence Score (E-score) | 1 | + | |||
| 1 | Luciferase Reporter Assay | [3] | |||
| Representative Target(s) Regulated by This miRNA | AN1-type zinc finger protein 5 (ZFAND5) | Target Info | |||
| Brain-derived neurotrophic factor (BDNF) | Target Info | ||||
| References | Top | ||||
|---|---|---|---|---|---|
| REF 1 | Inhibition of breast cancer cell proliferation and tumorigenesis by long non-coding RNA RPPH1 down-regulation of miR-122 expression. Cancer Cell Int. 2017 Nov 21;17:109. | ||||
| REF 2 | miR-122 targets NOD2 to decrease intestinal epithelial cell injury in Crohn's disease. Biochem Biophys Res Commun. 2013 Aug 16;438(1):133-9. | ||||
| REF 3 | miR-10a inhibits dendritic cell activation and Th1/Th17 cell immune responses in IBD. Gut. 2015 Nov;64(11):1755-64. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.