The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-106b-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uaaagugcugacagugcagau
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
The protein level of SETD2 was significantly increased upon tranfection of antagomir against miR-106b-5p (4.4- to 7.5-fold in 786-O cells, 3.4-to 5.9-fold in SN12-PM6 cells). Moreover, knockdown of miR-106b-5p with miR-106b-5p antagomir increased the luciferase activity in 786-O and SN12-PM6 cells, whereas mutation of miR-106b-5p recognition site abolished these effects. |
[1] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[1] |
Representative Target(s) Regulated by This miRNA |
Amyloid beta A4 protein (APP)
|
Target Info
|
|
Apoptosis mediating surface antigen FAS (FAS)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-186-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
caaagaauucuccuuuugggcu
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[2] |
Representative Target(s) Regulated by This miRNA |
Casein kinase II alpha (CSNK2A1)
|
Target Info
|
|
Fibroblast growth factor-2 (FGF2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-199b-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
cccaguguuuagacuaucuguuc
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[3] |
Representative Target(s) Regulated by This miRNA |
Epithelial discoidin domain receptor 1 (DDR1)
|
Target Info
|
|
Erbb2 tyrosine kinase receptor (HER2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-21-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uagcuuaucagacugauguuga
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-21 is a transcriptional target of SETD2. |
[4] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[4] |
Representative Target(s) Regulated by This miRNA |
Apoptosis antigen ligand (CD178)
|
Target Info
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-526b-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
gaaagugcuuccuuuuagaggc
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[5] |
Representative Target(s) Regulated by This miRNA |
Lysine N-methyltransferase 3A (SETD2)
|
Target Info
|
|
Matrix metalloproteinase-1 (MMP-1)
|
Target Info
|
|